Variant ID: vg0108147243 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 8147243 |
Reference Allele: G | Alternative Allele: C |
Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, C: 0.04, T: 0.03, others allele: 0.00, population size: 109. )
ATTAGTTTCATTAAATCAATAACTGAATATATTTTCACAATAAATCTATCTTAGGTTAAAAATATTATTATTTTTCTCTACAAACTTAATCAAACTTGAA[G/C]
CAATTTAACTTTGACCGAAAGATACTAATATTATTCTACATCGTCATCAAACTCTCAAGTAAATCATGTAAGTGTAAATATATACCCCATGGCAAGGACG
CGTCCTTGCCATGGGGTATATATTTACACTTACATGATTTACTTGAGAGTTTGATGACGATGTAGAATAATATTAGTATCTTTCGGTCAAAGTTAAATTG[C/G]
TTCAAGTTTGATTAAGTTTGTAGAGAAAAATAATAATATTTTTAACCTAAGATAGATTTATTGTGAAAATATATTCAGTTATTGATTTAATGAAACTAAT
Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 56.30% | 37.90% | 5.84% | 0.00% | NA |
All Indica | 2759 | 84.00% | 8.10% | 7.87% | 0.00% | NA |
All Japonica | 1512 | 15.10% | 81.50% | 3.37% | 0.00% | NA |
Aus | 269 | 3.30% | 96.30% | 0.37% | 0.00% | NA |
Indica I | 595 | 70.90% | 8.10% | 21.01% | 0.00% | NA |
Indica II | 465 | 88.60% | 4.30% | 7.10% | 0.00% | NA |
Indica III | 913 | 90.70% | 9.00% | 0.33% | 0.00% | NA |
Indica Intermediate | 786 | 83.50% | 9.40% | 7.12% | 0.00% | NA |
Temperate Japonica | 767 | 2.90% | 94.70% | 2.48% | 0.00% | NA |
Tropical Japonica | 504 | 30.80% | 64.30% | 4.96% | 0.00% | NA |
Japonica Intermediate | 241 | 21.20% | 75.90% | 2.90% | 0.00% | NA |
VI/Aromatic | 96 | 51.00% | 47.90% | 1.04% | 0.00% | NA |
Intermediate | 90 | 63.30% | 30.00% | 6.67% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0108147243 | G -> C | LOC_Os01g14530.1 | intron_variant ; MODIFIER | silent_mutation | Average:54.302; most accessible tissue: Zhenshan97 panicle, score: 76.605 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0108147243 | 7.67E-08 | NA | mr1134 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108147243 | 2.82E-07 | 1.84E-08 | mr1134 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108147243 | 6.99E-09 | NA | mr1135 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108147243 | 1.49E-06 | 1.05E-07 | mr1135 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108147243 | 7.55E-08 | NA | mr1504 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108147243 | 6.71E-07 | 1.38E-08 | mr1504 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108147243 | 3.79E-07 | NA | mr1672 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108147243 | NA | 2.72E-07 | mr1672 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108147243 | NA | 5.27E-31 | mr1745 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0108147243 | NA | 3.39E-18 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |