\
| Variant ID: vg0108044840 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 8044840 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 126. )
GTGGGAGCTTAGGGAAGGATTTGCACGCGACTAGGGAGAGAGAAAGCAGATGCACGTGCGGCCGAGGGAGATTCGCGCGCGACTGGAGAGAGAGGAAGCG[G/A]
ATGCGCTCAACCTGATAGGTTCGATGGTAGTGGTGGATAATTTGCATAAAATTTTTAAGGGTAGTGGGTCTTTAGCCGGACAATAATATGAAAAAAAAAC
GTTTTTTTTTCATATTATTGTCCGGCTAAAGACCCACTACCCTTAAAAATTTTATGCAAATTATCCACCACTACCATCGAACCTATCAGGTTGAGCGCAT[C/T]
CGCTTCCTCTCTCTCCAGTCGCGCGCGAATCTCCCTCGGCCGCACGTGCATCTGCTTTCTCTCTCCCTAGTCGCGTGCAAATCCTTCCCTAAGCTCCCAC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.40% | 7.60% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 11.90% | 88.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 2.60% | 0.00% | 0.00% | NA |
| Indica III | 913 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0108044840 | G -> A | LOC_Os01g14360.1 | upstream_gene_variant ; 3630.0bp to feature; MODIFIER | silent_mutation | Average:62.553; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0108044840 | G -> A | LOC_Os01g14370.1 | downstream_gene_variant ; 2528.0bp to feature; MODIFIER | silent_mutation | Average:62.553; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0108044840 | G -> A | LOC_Os01g14370.2 | downstream_gene_variant ; 2528.0bp to feature; MODIFIER | silent_mutation | Average:62.553; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| vg0108044840 | G -> A | LOC_Os01g14360-LOC_Os01g14370 | intergenic_region ; MODIFIER | silent_mutation | Average:62.553; most accessible tissue: Minghui63 panicle, score: 85.556 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0108044840 | NA | 1.58E-17 | mr1113 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 4.85E-18 | mr1114 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 1.30E-21 | mr1120 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 1.20E-21 | mr1247 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 3.68E-06 | mr1286 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 8.06E-06 | mr1349 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 5.32E-19 | mr1961 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | 9.05E-06 | NA | mr1068_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | 9.51E-09 | NA | mr1090_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 1.02E-21 | mr1120_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 9.38E-23 | mr1247_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 5.96E-10 | mr1388_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 1.02E-18 | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 5.18E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 4.18E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0108044840 | NA | 4.72E-15 | mr1961_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |