\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107845967:

Variant ID: vg0107845967 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7845967
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 281. )

Flanking Sequence (100 bp) in Reference Genome:


TGATTCACGATCAGAATTAAGCAGAGACTCTCTCAAAAAAAAAGAGAAGCAGATCGACTGTAAAATGTAGCAAATTCTCCATATATGGGAGTACTCCATC[A/C]
ATTTCAAAATAGATCAACCTAGATTAAAATAGAATAGTACAACGAATCTTGACGGTTCCTTTTCAACATAGAATTATTTTGGAACGGATCGGAAGGAGTA

Reverse complement sequence

TACTCCTTCCGATCCGTTCCAAAATAATTCTATGTTGAAAAGGAACCGTCAAGATTCGTTGTACTATTCTATTTTAATCTAGGTTGATCTATTTTGAAAT[T/G]
GATGGAGTACTCCCATATATGGAGAATTTGCTACATTTTACAGTCGATCTGCTTCTCTTTTTTTTTGAGAGAGTCTCTGCTTAATTCTGATCGTGAATCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 56.70% 42.80% 0.13% 0.36% NA
All Indica  2759 84.80% 14.50% 0.18% 0.51% NA
All Japonica  1512 3.60% 96.40% 0.00% 0.00% NA
Aus  269 87.40% 12.60% 0.00% 0.00% NA
Indica I  595 83.20% 16.30% 0.17% 0.34% NA
Indica II  465 93.80% 5.80% 0.22% 0.22% NA
Indica III  913 88.80% 10.20% 0.33% 0.66% NA
Indica Intermediate  786 76.10% 23.30% 0.00% 0.64% NA
Temperate Japonica  767 6.10% 93.90% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 50.00% 45.60% 1.11% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107845967 A -> DEL N N silent_mutation Average:58.345; most accessible tissue: Callus, score: 93.14 N N N N
vg0107845967 A -> C LOC_Os01g14010.1 upstream_gene_variant ; 1775.0bp to feature; MODIFIER silent_mutation Average:58.345; most accessible tissue: Callus, score: 93.14 N N N N
vg0107845967 A -> C LOC_Os01g14000.1 downstream_gene_variant ; 1309.0bp to feature; MODIFIER silent_mutation Average:58.345; most accessible tissue: Callus, score: 93.14 N N N N
vg0107845967 A -> C LOC_Os01g14000-LOC_Os01g14010 intergenic_region ; MODIFIER silent_mutation Average:58.345; most accessible tissue: Callus, score: 93.14 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107845967 5.41E-07 5.41E-07 mr1770 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107845967 NA 5.39E-06 mr1329_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107845967 NA 2.55E-06 mr1982_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251