\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107836036:

Variant ID: vg0107836036 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7836036
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTCCTTCTCTTTCTCTCTTTTCTTTTCTTTTTCCTTCTCTTTCTCTCTCTCCCGGCTTCTTTCTTTCTTCCTCTCTTTTCTTTTCTTTCTCTCTCCCTCG[G/C]
CTTCTCCCTTCCTCTCTCTCTCTTGGCTCTCTCTCTACCCGGCGGCACGGTGACAAACAGGGGGGCAGCGGCTCACCGACAGCGGCGGCGACGACGGCGC

Reverse complement sequence

GCGCCGTCGTCGCCGCCGCTGTCGGTGAGCCGCTGCCCCCCTGTTTGTCACCGTGCCGCCGGGTAGAGAGAGAGCCAAGAGAGAGAGAGGAAGGGAGAAG[C/G]
CGAGGGAGAGAGAAAGAAAAGAAAAGAGAGGAAGAAAGAAAGAAGCCGGGAGAGAGAGAAAGAGAAGGAAAAAGAAAAGAAAAGAGAGAAAGAGAAGGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.70% 2.70% 3.41% 0.15% NA
All Indica  2759 95.10% 2.10% 2.65% 0.11% NA
All Japonica  1512 99.70% 0.00% 0.13% 0.13% NA
Aus  269 43.50% 25.30% 31.23% 0.00% NA
Indica I  595 95.50% 0.70% 3.70% 0.17% NA
Indica II  465 94.80% 1.90% 3.01% 0.22% NA
Indica III  913 95.60% 2.20% 2.19% 0.00% NA
Indica Intermediate  786 94.40% 3.30% 2.16% 0.13% NA
Temperate Japonica  767 99.60% 0.00% 0.13% 0.26% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 1.00% 1.04% 0.00% NA
Intermediate  90 96.70% 0.00% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107836036 G -> DEL N N silent_mutation Average:30.848; most accessible tissue: Callus, score: 37.577 N N N N
vg0107836036 G -> C LOC_Os01g13970.1 upstream_gene_variant ; 3819.0bp to feature; MODIFIER silent_mutation Average:30.848; most accessible tissue: Callus, score: 37.577 N N N N
vg0107836036 G -> C LOC_Os01g13980.1 upstream_gene_variant ; 2219.0bp to feature; MODIFIER silent_mutation Average:30.848; most accessible tissue: Callus, score: 37.577 N N N N
vg0107836036 G -> C LOC_Os01g13990.1 downstream_gene_variant ; 1262.0bp to feature; MODIFIER silent_mutation Average:30.848; most accessible tissue: Callus, score: 37.577 N N N N
vg0107836036 G -> C LOC_Os01g13980-LOC_Os01g13990 intergenic_region ; MODIFIER silent_mutation Average:30.848; most accessible tissue: Callus, score: 37.577 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107836036 2.56E-06 3.75E-16 mr1317 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 3.69E-13 mr1317 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 6.95E-10 mr1608 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 1.42E-06 mr1818 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 2.50E-07 6.36E-41 mr1855 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 2.85E-22 mr1855 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 3.43E-15 mr1897 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 2.31E-06 mr1897 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 9.40E-11 mr1927 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 6.53E-06 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 2.42E-13 mr1317_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 2.76E-11 mr1317_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 9.32E-10 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 5.00E-08 mr1608_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 7.32E-12 mr1610_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 5.62E-08 mr1610_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 1.67E-15 mr1818_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 2.99E-10 mr1818_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 6.92E-43 mr1855_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 5.53E-20 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 9.07E-14 mr1897_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 6.21E-08 mr1897_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 7.88E-16 mr1914_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 2.06E-10 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 6.06E-18 mr1927_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036 NA 6.28E-11 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251