Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107836036:

Variant ID: vg0107836036 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7836036
Reference Allele: G	Alternative Allele: C
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTCCTTCTCTTTCTCTCTTTTCTTTTCTTTTTCCTTCTCTTTCTCTCTCTCCCGGCTTCTTTCTTTCTTCCTCTCTTTTCTTTTCTTTCTCTCTCCCTCG[G/C]
CTTCTCCCTTCCTCTCTCTCTCTTGGCTCTCTCTCTACCCGGCGGCACGGTGACAAACAGGGGGGCAGCGGCTCACCGACAGCGGCGGCGACGACGGCGC

Reverse complement sequence

GCGCCGTCGTCGCCGCCGCTGTCGGTGAGCCGCTGCCCCCCTGTTTGTCACCGTGCCGCCGGGTAGAGAGAGAGCCAAGAGAGAGAGAGGAAGGGAGAAG[C/G]
CGAGGGAGAGAGAAAGAAAAGAAAAGAGAGGAAGAAAGAAAGAAGCCGGGAGAGAGAGAAAGAGAAGGAAAAAGAAAAGAAAAGAGAGAAAGAGAAGGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.70%	2.70%	3.41%	0.15%	NA
All Indica	2759	95.10%	2.10%	2.65%	0.11%	NA
All Japonica	1512	99.70%	0.00%	0.13%	0.13%	NA
Aus	269	43.50%	25.30%	31.23%	0.00%	NA
Indica I	595	95.50%	0.70%	3.70%	0.17%	NA
Indica II	465	94.80%	1.90%	3.01%	0.22%	NA
Indica III	913	95.60%	2.20%	2.19%	0.00%	NA
Indica Intermediate	786	94.40%	3.30%	2.16%	0.13%	NA
Temperate Japonica	767	99.60%	0.00%	0.13%	0.26%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	97.90%	1.00%	1.04%	0.00%	NA
Intermediate	90	96.70%	0.00%	1.11%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107836036	G -> DEL	N	N	silent_mutation	Average:30.848; most accessible tissue: Callus, score: 37.577	N	N	N	N
vg0107836036	G -> C	LOC_Os01g13970.1	upstream_gene_variant ; 3819.0bp to feature; MODIFIER	silent_mutation	Average:30.848; most accessible tissue: Callus, score: 37.577	N	N	N	N
vg0107836036	G -> C	LOC_Os01g13980.1	upstream_gene_variant ; 2219.0bp to feature; MODIFIER	silent_mutation	Average:30.848; most accessible tissue: Callus, score: 37.577	N	N	N	N
vg0107836036	G -> C	LOC_Os01g13990.1	downstream_gene_variant ; 1262.0bp to feature; MODIFIER	silent_mutation	Average:30.848; most accessible tissue: Callus, score: 37.577	N	N	N	N
vg0107836036	G -> C	LOC_Os01g13980-LOC_Os01g13990	intergenic_region ; MODIFIER	silent_mutation	Average:30.848; most accessible tissue: Callus, score: 37.577	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107836036	2.56E-06	3.75E-16	mr1317	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	3.69E-13	mr1317	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	6.95E-10	mr1608	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	1.42E-06	mr1818	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	2.50E-07	6.36E-41	mr1855	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	2.85E-22	mr1855	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	3.43E-15	mr1897	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	2.31E-06	mr1897	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	9.40E-11	mr1927	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	6.53E-06	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	2.42E-13	mr1317_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	2.76E-11	mr1317_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	9.32E-10	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	5.00E-08	mr1608_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	7.32E-12	mr1610_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	5.62E-08	mr1610_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	1.67E-15	mr1818_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	2.99E-10	mr1818_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	6.92E-43	mr1855_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	5.53E-20	mr1855_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	9.07E-14	mr1897_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	6.21E-08	mr1897_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	7.88E-16	mr1914_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	2.06E-10	mr1914_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	6.06E-18	mr1927_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107836036	NA	6.28E-11	mr1927_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251