| Variant ID: vg0107836036 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7836036 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTCCTTCTCTTTCTCTCTTTTCTTTTCTTTTTCCTTCTCTTTCTCTCTCTCCCGGCTTCTTTCTTTCTTCCTCTCTTTTCTTTTCTTTCTCTCTCCCTCG[G/C]
CTTCTCCCTTCCTCTCTCTCTCTTGGCTCTCTCTCTACCCGGCGGCACGGTGACAAACAGGGGGGCAGCGGCTCACCGACAGCGGCGGCGACGACGGCGC
GCGCCGTCGTCGCCGCCGCTGTCGGTGAGCCGCTGCCCCCCTGTTTGTCACCGTGCCGCCGGGTAGAGAGAGAGCCAAGAGAGAGAGAGGAAGGGAGAAG[C/G]
CGAGGGAGAGAGAAAGAAAAGAAAAGAGAGGAAGAAAGAAAGAAGCCGGGAGAGAGAGAAAGAGAAGGAAAAAGAAAAGAAAAGAGAGAAAGAGAAGGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.70% | 2.70% | 3.41% | 0.15% | NA |
| All Indica | 2759 | 95.10% | 2.10% | 2.65% | 0.11% | NA |
| All Japonica | 1512 | 99.70% | 0.00% | 0.13% | 0.13% | NA |
| Aus | 269 | 43.50% | 25.30% | 31.23% | 0.00% | NA |
| Indica I | 595 | 95.50% | 0.70% | 3.70% | 0.17% | NA |
| Indica II | 465 | 94.80% | 1.90% | 3.01% | 0.22% | NA |
| Indica III | 913 | 95.60% | 2.20% | 2.19% | 0.00% | NA |
| Indica Intermediate | 786 | 94.40% | 3.30% | 2.16% | 0.13% | NA |
| Temperate Japonica | 767 | 99.60% | 0.00% | 0.13% | 0.26% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 96.70% | 0.00% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107836036 | G -> DEL | N | N | silent_mutation | Average:30.848; most accessible tissue: Callus, score: 37.577 | N | N | N | N |
| vg0107836036 | G -> C | LOC_Os01g13970.1 | upstream_gene_variant ; 3819.0bp to feature; MODIFIER | silent_mutation | Average:30.848; most accessible tissue: Callus, score: 37.577 | N | N | N | N |
| vg0107836036 | G -> C | LOC_Os01g13980.1 | upstream_gene_variant ; 2219.0bp to feature; MODIFIER | silent_mutation | Average:30.848; most accessible tissue: Callus, score: 37.577 | N | N | N | N |
| vg0107836036 | G -> C | LOC_Os01g13990.1 | downstream_gene_variant ; 1262.0bp to feature; MODIFIER | silent_mutation | Average:30.848; most accessible tissue: Callus, score: 37.577 | N | N | N | N |
| vg0107836036 | G -> C | LOC_Os01g13980-LOC_Os01g13990 | intergenic_region ; MODIFIER | silent_mutation | Average:30.848; most accessible tissue: Callus, score: 37.577 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107836036 | 2.56E-06 | 3.75E-16 | mr1317 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107836036 | NA | 3.69E-13 | mr1317 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107836036 | NA | 6.95E-10 | mr1608 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107836036 | NA | 1.42E-06 | mr1818 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107836036 | 2.50E-07 | 6.36E-41 | mr1855 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107836036 | NA | 2.85E-22 | mr1855 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107836036 | NA | 3.43E-15 | mr1897 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107836036 | NA | 2.31E-06 | mr1897 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107836036 | NA | 9.40E-11 | mr1927 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107836036 | NA | 6.53E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/