| Variant ID: vg0107834363 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7834363 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTGCAGTGGATGTACACTTTACCCGTACTCCGCGACTGCCCAACACATGAGCCTCGTCCCAACACATGAGACGTGTCATGGCAAAGCTTTTCGATAACCT[C/T]
GCATTGGCAGTACCCGCTCCATGAACTTCACATCCTCATGCACTCTAGGCGTACACGGTTTCTAGCAGTGAGAGGAGTTCTGGCGCACCCGGGAAGAAAA
TTTTCTTCCCGGGTGCGCCAGAACTCCTCTCACTGCTAGAAACCGTGTACGCCTAGAGTGCATGAGGATGTGAAGTTCATGGAGCGGGTACTGCCAATGC[G/A]
AGGTTATCGAAAAGCTTTGCCATGACACGTCTCATGTGTTGGGACGAGGCTCATGTGTTGGGCAGTCGCGGAGTACGGGTAAAGTGTACATCCACTGCAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 42.10% | 18.20% | 14.62% | 25.12% | NA |
| All Indica | 2759 | 37.60% | 2.90% | 18.45% | 41.10% | NA |
| All Japonica | 1512 | 54.60% | 43.90% | 0.40% | 1.06% | NA |
| Aus | 269 | 33.80% | 0.70% | 61.71% | 3.72% | NA |
| Indica I | 595 | 24.40% | 1.50% | 21.68% | 52.44% | NA |
| Indica II | 465 | 21.30% | 1.10% | 15.48% | 62.15% | NA |
| Indica III | 913 | 53.00% | 5.10% | 17.09% | 24.75% | NA |
| Indica Intermediate | 786 | 39.30% | 2.30% | 19.34% | 39.06% | NA |
| Temperate Japonica | 767 | 90.50% | 7.70% | 0.13% | 1.69% | NA |
| Tropical Japonica | 504 | 8.30% | 90.90% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 37.30% | 61.00% | 0.83% | 0.83% | NA |
| VI/Aromatic | 96 | 6.20% | 88.50% | 3.12% | 2.08% | NA |
| Intermediate | 90 | 33.30% | 31.10% | 7.78% | 27.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107834363 | C -> T | LOC_Os01g13970.1 | upstream_gene_variant ; 2146.0bp to feature; MODIFIER | silent_mutation | Average:12.565; most accessible tissue: Zhenshan97 root, score: 23.888 | N | N | N | N |
| vg0107834363 | C -> T | LOC_Os01g13980.1 | upstream_gene_variant ; 546.0bp to feature; MODIFIER | silent_mutation | Average:12.565; most accessible tissue: Zhenshan97 root, score: 23.888 | N | N | N | N |
| vg0107834363 | C -> T | LOC_Os01g13990.1 | downstream_gene_variant ; 2935.0bp to feature; MODIFIER | silent_mutation | Average:12.565; most accessible tissue: Zhenshan97 root, score: 23.888 | N | N | N | N |
| vg0107834363 | C -> T | LOC_Os01g13980-LOC_Os01g13990 | intergenic_region ; MODIFIER | silent_mutation | Average:12.565; most accessible tissue: Zhenshan97 root, score: 23.888 | N | N | N | N |
| vg0107834363 | C -> DEL | N | N | silent_mutation | Average:12.565; most accessible tissue: Zhenshan97 root, score: 23.888 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107834363 | NA | 7.56E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107834363 | NA | 2.38E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107834363 | NA | 2.38E-07 | mr1715 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107834363 | NA | 7.96E-07 | mr1554_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107834363 | 1.99E-06 | 5.61E-22 | mr1593_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107834363 | NA | 1.52E-11 | mr1789_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107834363 | NA | 1.62E-08 | mr1952_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |