Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107834363:

Variant ID: vg0107834363 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7834363
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CTGCAGTGGATGTACACTTTACCCGTACTCCGCGACTGCCCAACACATGAGCCTCGTCCCAACACATGAGACGTGTCATGGCAAAGCTTTTCGATAACCT[C/T]
GCATTGGCAGTACCCGCTCCATGAACTTCACATCCTCATGCACTCTAGGCGTACACGGTTTCTAGCAGTGAGAGGAGTTCTGGCGCACCCGGGAAGAAAA

Reverse complement sequence

TTTTCTTCCCGGGTGCGCCAGAACTCCTCTCACTGCTAGAAACCGTGTACGCCTAGAGTGCATGAGGATGTGAAGTTCATGGAGCGGGTACTGCCAATGC[G/A]
AGGTTATCGAAAAGCTTTGCCATGACACGTCTCATGTGTTGGGACGAGGCTCATGTGTTGGGCAGTCGCGGAGTACGGGTAAAGTGTACATCCACTGCAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	42.10%	18.20%	14.62%	25.12%	NA
All Indica	2759	37.60%	2.90%	18.45%	41.10%	NA
All Japonica	1512	54.60%	43.90%	0.40%	1.06%	NA
Aus	269	33.80%	0.70%	61.71%	3.72%	NA
Indica I	595	24.40%	1.50%	21.68%	52.44%	NA
Indica II	465	21.30%	1.10%	15.48%	62.15%	NA
Indica III	913	53.00%	5.10%	17.09%	24.75%	NA
Indica Intermediate	786	39.30%	2.30%	19.34%	39.06%	NA
Temperate Japonica	767	90.50%	7.70%	0.13%	1.69%	NA
Tropical Japonica	504	8.30%	90.90%	0.60%	0.20%	NA
Japonica Intermediate	241	37.30%	61.00%	0.83%	0.83%	NA
VI/Aromatic	96	6.20%	88.50%	3.12%	2.08%	NA
Intermediate	90	33.30%	31.10%	7.78%	27.78%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107834363	C -> T	LOC_Os01g13970.1	upstream_gene_variant ; 2146.0bp to feature; MODIFIER	silent_mutation	Average:12.565; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0107834363	C -> T	LOC_Os01g13980.1	upstream_gene_variant ; 546.0bp to feature; MODIFIER	silent_mutation	Average:12.565; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0107834363	C -> T	LOC_Os01g13990.1	downstream_gene_variant ; 2935.0bp to feature; MODIFIER	silent_mutation	Average:12.565; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0107834363	C -> T	LOC_Os01g13980-LOC_Os01g13990	intergenic_region ; MODIFIER	silent_mutation	Average:12.565; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N
vg0107834363	C -> DEL	N	N	silent_mutation	Average:12.565; most accessible tissue: Zhenshan97 root, score: 23.888	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107834363	NA	7.56E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834363	NA	2.38E-07	mr1554	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834363	NA	2.38E-07	mr1715	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834363	NA	7.96E-07	mr1554_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834363	1.99E-06	5.61E-22	mr1593_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834363	NA	1.52E-11	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107834363	NA	1.62E-08	mr1952_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251