\
| Variant ID: vg0107829155 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7829155 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CAGGTAGCTTTGTGTGTTTACTGTGGAATTGACAGGCTTCACATCGCTGGACCATGTCACATGCATCTTTAAGGGCGGTTGGCCAGAAAAAGCCTTGTCG[A/G]
AAAGCTTTGCCGACCAATGTTCGACCGGTGGCGTGTGACCCACATATGCCTTCATGTATGTCGAGGAGGAGGTGTCTGTCATCGTCGGTCGAGACGCATT
AATGCGTCTCGACCGACGATGACAGACACCTCCTCCTCGACATACATGAAGGCATATGTGGGTCACACGCCACCGGTCGAACATTGGTCGGCAAAGCTTT[T/C]
CGACAAGGCTTTTTCTGGCCAACCGCCCTTAAAGATGCATGTGACATGGTCCAGCGATGTGAAGCCTGTCAATTCCACAGTAAACACACAAAGCTACCTG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 38.60% | 0.70% | 11.68% | 48.96% | NA |
| All Indica | 2759 | 6.40% | 1.00% | 12.29% | 80.36% | NA |
| All Japonica | 1512 | 97.00% | 0.10% | 0.07% | 2.91% | NA |
| Aus | 269 | 16.40% | 1.90% | 76.58% | 5.20% | NA |
| Indica I | 595 | 5.40% | 0.50% | 5.55% | 88.57% | NA |
| Indica II | 465 | 3.90% | 1.50% | 6.45% | 88.17% | NA |
| Indica III | 913 | 7.20% | 0.80% | 16.10% | 75.90% | NA |
| Indica Intermediate | 786 | 7.60% | 1.30% | 16.41% | 74.68% | NA |
| Temperate Japonica | 767 | 97.80% | 0.10% | 0.00% | 2.09% | NA |
| Tropical Japonica | 504 | 95.20% | 0.00% | 0.20% | 4.56% | NA |
| Japonica Intermediate | 241 | 97.90% | 0.00% | 0.00% | 2.07% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 2.08% | 3.12% | NA |
| Intermediate | 90 | 54.40% | 1.10% | 4.44% | 40.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107829155 | A -> G | LOC_Os01g13960.1 | downstream_gene_variant ; 1603.0bp to feature; MODIFIER | silent_mutation | Average:10.945; most accessible tissue: Minghui63 root, score: 19.68 | N | N | N | N |
| vg0107829155 | A -> G | LOC_Os01g13980.1 | downstream_gene_variant ; 3194.0bp to feature; MODIFIER | silent_mutation | Average:10.945; most accessible tissue: Minghui63 root, score: 19.68 | N | N | N | N |
| vg0107829155 | A -> G | LOC_Os01g13970.1 | intron_variant ; MODIFIER | silent_mutation | Average:10.945; most accessible tissue: Minghui63 root, score: 19.68 | N | N | N | N |
| vg0107829155 | A -> DEL | N | N | silent_mutation | Average:10.945; most accessible tissue: Minghui63 root, score: 19.68 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107829155 | NA | 4.45E-08 | mr1648 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107829155 | 9.65E-06 | NA | mr1072_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107829155 | 4.03E-06 | NA | mr1072_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107829155 | NA | 9.89E-09 | mr1600_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107829155 | NA | 1.87E-07 | mr1804_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107829155 | NA | 2.37E-07 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |