\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107829155:

Variant ID: vg0107829155 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7829155
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGGTAGCTTTGTGTGTTTACTGTGGAATTGACAGGCTTCACATCGCTGGACCATGTCACATGCATCTTTAAGGGCGGTTGGCCAGAAAAAGCCTTGTCG[A/G]
AAAGCTTTGCCGACCAATGTTCGACCGGTGGCGTGTGACCCACATATGCCTTCATGTATGTCGAGGAGGAGGTGTCTGTCATCGTCGGTCGAGACGCATT

Reverse complement sequence

AATGCGTCTCGACCGACGATGACAGACACCTCCTCCTCGACATACATGAAGGCATATGTGGGTCACACGCCACCGGTCGAACATTGGTCGGCAAAGCTTT[T/C]
CGACAAGGCTTTTTCTGGCCAACCGCCCTTAAAGATGCATGTGACATGGTCCAGCGATGTGAAGCCTGTCAATTCCACAGTAAACACACAAAGCTACCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 38.60% 0.70% 11.68% 48.96% NA
All Indica  2759 6.40% 1.00% 12.29% 80.36% NA
All Japonica  1512 97.00% 0.10% 0.07% 2.91% NA
Aus  269 16.40% 1.90% 76.58% 5.20% NA
Indica I  595 5.40% 0.50% 5.55% 88.57% NA
Indica II  465 3.90% 1.50% 6.45% 88.17% NA
Indica III  913 7.20% 0.80% 16.10% 75.90% NA
Indica Intermediate  786 7.60% 1.30% 16.41% 74.68% NA
Temperate Japonica  767 97.80% 0.10% 0.00% 2.09% NA
Tropical Japonica  504 95.20% 0.00% 0.20% 4.56% NA
Japonica Intermediate  241 97.90% 0.00% 0.00% 2.07% NA
VI/Aromatic  96 94.80% 0.00% 2.08% 3.12% NA
Intermediate  90 54.40% 1.10% 4.44% 40.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107829155 A -> G LOC_Os01g13960.1 downstream_gene_variant ; 1603.0bp to feature; MODIFIER silent_mutation Average:10.945; most accessible tissue: Minghui63 root, score: 19.68 N N N N
vg0107829155 A -> G LOC_Os01g13980.1 downstream_gene_variant ; 3194.0bp to feature; MODIFIER silent_mutation Average:10.945; most accessible tissue: Minghui63 root, score: 19.68 N N N N
vg0107829155 A -> G LOC_Os01g13970.1 intron_variant ; MODIFIER silent_mutation Average:10.945; most accessible tissue: Minghui63 root, score: 19.68 N N N N
vg0107829155 A -> DEL N N silent_mutation Average:10.945; most accessible tissue: Minghui63 root, score: 19.68 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107829155 NA 4.45E-08 mr1648 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107829155 9.65E-06 NA mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107829155 4.03E-06 NA mr1072_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107829155 NA 9.89E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107829155 NA 1.87E-07 mr1804_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107829155 NA 2.37E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251