\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107778488:

Variant ID: vg0107778488 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 7778488
Reference Allele: TAlternative Allele: A,TA
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCTTGCGTGAATATCACGGGAAAAAGCCAATTTATGCGCTCCGCCATGGACACTCCAAGAAAAGCTCTGAAATTTTGTTTGTAACATCGAGTTTTTTT[T/A,TA]
AAAATCTTTTACACAACGCATGCATTTGTTTCAAAAAATTTTGGACATGAACTAAGAGCACCCGCAATGGTAAAGTAAGGTGCTCTCTATAAAACATTTA

Reverse complement sequence

TAAATGTTTTATAGAGAGCACCTTACTTTACCATTGCGGGTGCTCTTAGTTCATGTCCAAAATTTTTTGAAACAAATGCATGCGTTGTGTAAAAGATTTT[A/T,TA]
AAAAAAACTCGATGTTACAAACAAAATTTCAGAGCTTTTCTTGGAGTGTCCATGGCGGAGCGCATAAATTGGCTTTTTCCCGTGATATTCACGCAAGCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.50% 18.20% 0.06% 0.00% TA: 0.23%
All Indica  2759 99.10% 0.50% 0.11% 0.00% TA: 0.29%
All Japonica  1512 47.80% 52.10% 0.00% 0.00% TA: 0.13%
Aus  269 85.50% 14.10% 0.00% 0.00% TA: 0.37%
Indica I  595 98.80% 0.30% 0.17% 0.00% TA: 0.67%
Indica II  465 99.60% 0.20% 0.00% 0.00% TA: 0.22%
Indica III  913 99.70% 0.20% 0.11% 0.00% NA
Indica Intermediate  786 98.50% 1.00% 0.13% 0.00% TA: 0.38%
Temperate Japonica  767 10.20% 89.70% 0.00% 0.00% TA: 0.13%
Tropical Japonica  504 96.60% 3.20% 0.00% 0.00% TA: 0.20%
Japonica Intermediate  241 65.60% 34.40% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 83.30% 16.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107778488 T -> TA LOC_Os01g13880.1 upstream_gene_variant ; 1762.0bp to feature; MODIFIER silent_mutation Average:33.016; most accessible tissue: Callus, score: 55.78 N N N N
vg0107778488 T -> TA LOC_Os01g13890.1 upstream_gene_variant ; 4314.0bp to feature; MODIFIER silent_mutation Average:33.016; most accessible tissue: Callus, score: 55.78 N N N N
vg0107778488 T -> TA LOC_Os01g13860.1 downstream_gene_variant ; 4207.0bp to feature; MODIFIER silent_mutation Average:33.016; most accessible tissue: Callus, score: 55.78 N N N N
vg0107778488 T -> TA LOC_Os01g13870.1 downstream_gene_variant ; 1161.0bp to feature; MODIFIER silent_mutation Average:33.016; most accessible tissue: Callus, score: 55.78 N N N N
vg0107778488 T -> TA LOC_Os01g13870-LOC_Os01g13880 intergenic_region ; MODIFIER silent_mutation Average:33.016; most accessible tissue: Callus, score: 55.78 N N N N
vg0107778488 T -> A LOC_Os01g13880.1 upstream_gene_variant ; 1763.0bp to feature; MODIFIER silent_mutation Average:33.016; most accessible tissue: Callus, score: 55.78 N N N N
vg0107778488 T -> A LOC_Os01g13890.1 upstream_gene_variant ; 4315.0bp to feature; MODIFIER silent_mutation Average:33.016; most accessible tissue: Callus, score: 55.78 N N N N
vg0107778488 T -> A LOC_Os01g13860.1 downstream_gene_variant ; 4206.0bp to feature; MODIFIER silent_mutation Average:33.016; most accessible tissue: Callus, score: 55.78 N N N N
vg0107778488 T -> A LOC_Os01g13870.1 downstream_gene_variant ; 1160.0bp to feature; MODIFIER silent_mutation Average:33.016; most accessible tissue: Callus, score: 55.78 N N N N
vg0107778488 T -> A LOC_Os01g13870-LOC_Os01g13880 intergenic_region ; MODIFIER silent_mutation Average:33.016; most accessible tissue: Callus, score: 55.78 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107778488 NA 5.59E-34 Grain_thickness All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107778488 NA 5.13E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 3.92E-07 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 9.00E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 9.77E-06 mr1272 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 2.89E-06 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.70E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 7.80E-09 mr1691 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.57E-13 mr1741 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.73E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.77E-06 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.69E-06 mr1206_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 5.28E-06 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 5.54E-08 mr1229_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 6.22E-08 mr1229_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 5.20E-09 mr1235_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.15E-07 mr1250_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 7.89E-07 mr1250_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 3.41E-08 mr1252_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 2.47E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 8.40E-06 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.39E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 8.06E-11 mr1580_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 2.74E-10 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.08E-06 mr1680_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 2.84E-06 mr1693_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 1.57E-06 NA mr1705_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 2.17E-10 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.35E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 3.71E-06 mr1763_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 5.67E-39 mr1771_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 4.60E-07 mr1785_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 9.37E-14 mr1789_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.84E-07 mr1837_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.18E-13 mr1844_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 9.29E-06 mr1844_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 1.43E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488 NA 2.62E-08 mr1880_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251