Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107778488:

Variant ID: vg0107778488 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 7778488
Reference Allele: T	Alternative Allele: A,TA
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.01, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:

CTGCTTGCGTGAATATCACGGGAAAAAGCCAATTTATGCGCTCCGCCATGGACACTCCAAGAAAAGCTCTGAAATTTTGTTTGTAACATCGAGTTTTTTT[T/A,TA]
AAAATCTTTTACACAACGCATGCATTTGTTTCAAAAAATTTTGGACATGAACTAAGAGCACCCGCAATGGTAAAGTAAGGTGCTCTCTATAAAACATTTA

Reverse complement sequence

TAAATGTTTTATAGAGAGCACCTTACTTTACCATTGCGGGTGCTCTTAGTTCATGTCCAAAATTTTTTGAAACAAATGCATGCGTTGTGTAAAAGATTTT[A/T,TA]
AAAAAAACTCGATGTTACAAACAAAATTTCAGAGCTTTTCTTGGAGTGTCCATGGCGGAGCGCATAAATTGGCTTTTTCCCGTGATATTCACGCAAGCAG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.50%	18.20%	0.06%	0.00%	TA: 0.23%
All Indica	2759	99.10%	0.50%	0.11%	0.00%	TA: 0.29%
All Japonica	1512	47.80%	52.10%	0.00%	0.00%	TA: 0.13%
Aus	269	85.50%	14.10%	0.00%	0.00%	TA: 0.37%
Indica I	595	98.80%	0.30%	0.17%	0.00%	TA: 0.67%
Indica II	465	99.60%	0.20%	0.00%	0.00%	TA: 0.22%
Indica III	913	99.70%	0.20%	0.11%	0.00%	NA
Indica Intermediate	786	98.50%	1.00%	0.13%	0.00%	TA: 0.38%
Temperate Japonica	767	10.20%	89.70%	0.00%	0.00%	TA: 0.13%
Tropical Japonica	504	96.60%	3.20%	0.00%	0.00%	TA: 0.20%
Japonica Intermediate	241	65.60%	34.40%	0.00%	0.00%	NA
VI/Aromatic	96	93.80%	6.20%	0.00%	0.00%	NA
Intermediate	90	83.30%	16.70%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107778488	T -> TA	LOC_Os01g13880.1	upstream_gene_variant ; 1762.0bp to feature; MODIFIER	silent_mutation	Average:33.016; most accessible tissue: Callus, score: 55.78	N	N	N	N
vg0107778488	T -> TA	LOC_Os01g13890.1	upstream_gene_variant ; 4314.0bp to feature; MODIFIER	silent_mutation	Average:33.016; most accessible tissue: Callus, score: 55.78	N	N	N	N
vg0107778488	T -> TA	LOC_Os01g13860.1	downstream_gene_variant ; 4207.0bp to feature; MODIFIER	silent_mutation	Average:33.016; most accessible tissue: Callus, score: 55.78	N	N	N	N
vg0107778488	T -> TA	LOC_Os01g13870.1	downstream_gene_variant ; 1161.0bp to feature; MODIFIER	silent_mutation	Average:33.016; most accessible tissue: Callus, score: 55.78	N	N	N	N
vg0107778488	T -> TA	LOC_Os01g13870-LOC_Os01g13880	intergenic_region ; MODIFIER	silent_mutation	Average:33.016; most accessible tissue: Callus, score: 55.78	N	N	N	N
vg0107778488	T -> A	LOC_Os01g13880.1	upstream_gene_variant ; 1763.0bp to feature; MODIFIER	silent_mutation	Average:33.016; most accessible tissue: Callus, score: 55.78	N	N	N	N
vg0107778488	T -> A	LOC_Os01g13890.1	upstream_gene_variant ; 4315.0bp to feature; MODIFIER	silent_mutation	Average:33.016; most accessible tissue: Callus, score: 55.78	N	N	N	N
vg0107778488	T -> A	LOC_Os01g13860.1	downstream_gene_variant ; 4206.0bp to feature; MODIFIER	silent_mutation	Average:33.016; most accessible tissue: Callus, score: 55.78	N	N	N	N
vg0107778488	T -> A	LOC_Os01g13870.1	downstream_gene_variant ; 1160.0bp to feature; MODIFIER	silent_mutation	Average:33.016; most accessible tissue: Callus, score: 55.78	N	N	N	N
vg0107778488	T -> A	LOC_Os01g13870-LOC_Os01g13880	intergenic_region ; MODIFIER	silent_mutation	Average:33.016; most accessible tissue: Callus, score: 55.78	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107778488	NA	5.59E-34	Grain_thickness	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107778488	NA	5.13E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	3.92E-07	mr1229	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	9.00E-08	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	9.77E-06	mr1272	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	2.89E-06	mr1295	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.70E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	7.80E-09	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.57E-13	mr1741	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.73E-06	mr1045_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.77E-06	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.69E-06	mr1206_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	5.28E-06	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	5.54E-08	mr1229_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	6.22E-08	mr1229_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	5.20E-09	mr1235_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.15E-07	mr1250_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	7.89E-07	mr1250_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	3.41E-08	mr1252_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	2.47E-06	mr1263_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	8.40E-06	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.39E-07	mr1570_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	8.06E-11	mr1580_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	2.74E-10	mr1624_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.08E-06	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	2.84E-06	mr1693_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	1.57E-06	NA	mr1705_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	2.17E-10	mr1741_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.35E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	3.71E-06	mr1763_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	5.67E-39	mr1771_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	4.60E-07	mr1785_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	9.37E-14	mr1789_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.84E-07	mr1837_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.18E-13	mr1844_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	9.29E-06	mr1844_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	1.43E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107778488	NA	2.62E-08	mr1880_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251