\
| Variant ID: vg0107766597 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7766597 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TATTTTTTATTTATTATTAAACCTAATTAATCCATCATTAGTAAATATTTACTGTAGCACTATATTGCCAAATCATGCGCACTTAGACTTAAAAGATTTG[T/C]
CTCGCAATTTACACGTAATCTGTGTAATTAGTTATTTTTTTCAATATTTATTATTCTATGCATGTATCAAAACATTCGATGTGACATGTGTAAAATTTTG
CAAAATTTTACACATGTCACATCGAATGTTTTGATACATGCATAGAATAATAAATATTGAAAAAAATAACTAATTACACAGATTACGTGTAAATTGCGAG[A/G]
CAAATCTTTTAAGTCTAAGTGCGCATGATTTGGCAATATAGTGCTACAGTAAATATTTACTAATGATGGATTAATTAGGTTTAATAATAAATAAAAAATA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.00% | 18.00% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 47.90% | 52.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 85.90% | 14.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 10.20% | 89.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 96.80% | 3.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 94.80% | 5.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107766597 | T -> C | LOC_Os01g13840.1 | upstream_gene_variant ; 563.0bp to feature; MODIFIER | silent_mutation | Average:41.673; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0107766597 | T -> C | LOC_Os01g13850.1 | upstream_gene_variant ; 428.0bp to feature; MODIFIER | silent_mutation | Average:41.673; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg0107766597 | T -> C | LOC_Os01g13840-LOC_Os01g13850 | intergenic_region ; MODIFIER | silent_mutation | Average:41.673; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107766597 | NA | 6.52E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 7.61E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 7.00E-09 | mr1271 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 7.66E-07 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 2.45E-06 | mr1330 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 7.46E-06 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 8.89E-10 | mr1486 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 8.93E-06 | mr1548 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 1.40E-06 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 9.09E-10 | mr1629 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | 6.56E-06 | 1.01E-09 | mr1691 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 2.75E-13 | mr1741 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 8.80E-06 | mr1206_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 1.31E-07 | mr1229_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 2.94E-07 | mr1229_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 2.05E-07 | mr1250_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 8.67E-07 | mr1250_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 1.09E-07 | mr1252_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 1.08E-16 | mr1539_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 8.24E-07 | mr1570_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 8.06E-11 | mr1580_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 2.05E-09 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 2.14E-06 | mr1680_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 9.52E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 2.36E-06 | mr1785_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 2.17E-12 | mr1789_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 1.46E-12 | mr1844_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 2.88E-07 | mr1880_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107766597 | NA | 1.27E-07 | mr1880_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |