\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107645362:

Variant ID: vg0107645362 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7645362
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGATGGTGAGCGGCGTGGGAAACACAGTAGAGGACGCGGGGAGCTCAGGCAACTTGGCAAAATGAGAAAGGGAGGTGCGGGGATGGTATTTACAGGCTCG[G/A]
GAGGCGGCGAGGAGCTCGGGTCGAGGTGGCAACGGCTAGAGGAGTGGGGGCGGTGTCATGGGGAGAGAGGAGTTGCGGCGTCGATTCCCGCGGGTAGAGT

Reverse complement sequence

ACTCTACCCGCGGGAATCGACGCCGCAACTCCTCTCTCCCCATGACACCGCCCCCACTCCTCTAGCCGTTGCCACCTCGACCCGAGCTCCTCGCCGCCTC[C/T]
CGAGCCTGTAAATACCATCCCCGCACCTCCCTTTCTCATTTTGCCAAGTTGCCTGAGCTCCCCGCGTCCTCTACTGTGTTTCCCACGCCGCTCACCATCT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 87.40% 12.60% 0.00% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 63.00% 37.00% 0.00% 0.00% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 98.70% 1.30% 0.00% 0.00% NA
Indica II  465 99.40% 0.60% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.10% 0.90% 0.00% 0.00% NA
Temperate Japonica  767 93.60% 6.40% 0.00% 0.00% NA
Tropical Japonica  504 24.20% 75.80% 0.00% 0.00% NA
Japonica Intermediate  241 46.90% 53.10% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107645362 G -> A LOC_Os01g13630.1 upstream_gene_variant ; 2238.0bp to feature; MODIFIER silent_mutation Average:78.126; most accessible tissue: Zhenshan97 flag leaf, score: 88.765 N N N N
vg0107645362 G -> A LOC_Os01g13640.1 upstream_gene_variant ; 3295.0bp to feature; MODIFIER silent_mutation Average:78.126; most accessible tissue: Zhenshan97 flag leaf, score: 88.765 N N N N
vg0107645362 G -> A LOC_Os01g13620.1 downstream_gene_variant ; 4447.0bp to feature; MODIFIER silent_mutation Average:78.126; most accessible tissue: Zhenshan97 flag leaf, score: 88.765 N N N N
vg0107645362 G -> A LOC_Os01g13630-LOC_Os01g13640 intergenic_region ; MODIFIER silent_mutation Average:78.126; most accessible tissue: Zhenshan97 flag leaf, score: 88.765 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107645362 G A -0.01 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107645362 NA 3.05E-18 mr1715 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 4.09E-07 2.01E-09 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 2.30E-06 mr1206_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 3.28E-08 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 1.59E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 2.53E-06 mr1369_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 5.84E-06 mr1419_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 1.50E-06 mr1452_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 1.35E-07 mr1453_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 9.04E-07 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 6.46E-07 4.98E-09 mr1470_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 2.36E-06 mr1472_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 4.68E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 3.65E-06 mr1483_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 3.76E-09 mr1582_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 1.16E-06 mr1582_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 2.83E-07 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 NA 6.46E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 4.05E-07 1.40E-07 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107645362 2.10E-06 NA mr1933_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251