\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107628303:

Variant ID: vg0107628303 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7628303
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTAAAAAGTTTAAGTAATTATTTATTCTTTTCATATCATTTGATTCATTGTTAAATATATTTTTATGCACATATATAATTTTACATATTTCACAAAAA[A/T]
TTTTGAATAAGACGAATGGTCAAATATGTGCTAAAAAGTCAACGGTGTCAAATATTTTGAAACGGAGTATTTTGGTTCCAATTTTGTAGTATACCAGATA

Reverse complement sequence

TATCTGGTATACTACAAAATTGGAACCAAAATACTCCGTTTCAAAATATTTGACACCGTTGACTTTTTAGCACATATTTGACCATTCGTCTTATTCAAAA[T/A]
TTTTTGTGAAATATGTAAAATTATATATGTGCATAAAAATATATTTAACAATGAATCAAATGATATGAAAAGAATAAATAATTACTTAAACTTTTTAAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.80% 38.90% 1.02% 0.34% NA
All Indica  2759 89.80% 8.30% 1.49% 0.43% NA
All Japonica  1512 3.10% 96.60% 0.20% 0.07% NA
Aus  269 86.20% 13.80% 0.00% 0.00% NA
Indica I  595 94.60% 1.70% 3.03% 0.67% NA
Indica II  465 84.10% 13.30% 2.37% 0.22% NA
Indica III  913 88.80% 10.60% 0.33% 0.22% NA
Indica Intermediate  786 90.70% 7.50% 1.15% 0.64% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.60% 0.20% 0.00% NA
Japonica Intermediate  241 1.20% 97.50% 0.83% 0.41% NA
VI/Aromatic  96 19.80% 80.20% 0.00% 0.00% NA
Intermediate  90 53.30% 38.90% 4.44% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107628303 A -> T LOC_Os01g13610.1 upstream_gene_variant ; 3742.0bp to feature; MODIFIER silent_mutation Average:57.484; most accessible tissue: Zhenshan97 root, score: 93.769 N N N N
vg0107628303 A -> T LOC_Os01g13610-LOC_Os01g13620 intergenic_region ; MODIFIER silent_mutation Average:57.484; most accessible tissue: Zhenshan97 root, score: 93.769 N N N N
vg0107628303 A -> DEL N N silent_mutation Average:57.484; most accessible tissue: Zhenshan97 root, score: 93.769 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107628303 A T 0.0 0.0 0.0 0.0 0.01 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107628303 NA 7.15E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 8.40E-06 mr1433 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 5.11E-06 5.11E-06 mr1483 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 1.68E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 8.09E-08 2.47E-19 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 6.66E-11 mr1751 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 2.74E-06 8.62E-18 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 6.74E-07 mr1795 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 1.77E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 4.66E-11 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 3.38E-09 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 5.28E-24 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 8.35E-07 mr1943 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 1.17E-06 1.13E-15 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 6.85E-07 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 1.51E-07 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 1.05E-12 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 1.39E-13 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 3.18E-25 mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 8.28E-08 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107628303 NA 9.50E-11 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251