\
| Variant ID: vg0107608673 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7608673 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GTTGTACCGGGAAGCAATCTTGACCGGACACTCAACCCCGATTCACTCAAATATACTCCCTTTCGTTTGAAAAAAAAAAGAATCAGGGCTGAATGTAACA[A/T]
ATTTTAGTAAAAAAACTCTAAACGAATGCATGTCCAGATTTATAGTTCTAGAATGTATCACATCGAGTATTAAGGGAGAACAAAATACCATAATGTGCAT
ATGCACATTATGGTATTTTGTTCTCCCTTAATACTCGATGTGATACATTCTAGAACTATAAATCTGGACATGCATTCGTTTAGAGTTTTTTTACTAAAAT[T/A]
TGTTACATTCAGCCCTGATTCTTTTTTTTTTCAAACGAAAGGGAGTATATTTGAGTGAATCGGGGTTGAGTGTCCGGTCAAGATTGCTTCCCGGTACAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 67.10% | 32.80% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 99.20% | 0.80% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 6.70% | 93.30% | 0.07% | 0.00% | NA |
| Aus | 269 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.30% | 1.40% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 7.60% | 92.30% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 7.10% | 92.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 19.80% | 80.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 38.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107608673 | A -> T | LOC_Os01g13600.1 | upstream_gene_variant ; 2128.0bp to feature; MODIFIER | silent_mutation | Average:42.772; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| vg0107608673 | A -> T | LOC_Os01g13600-LOC_Os01g13610 | intergenic_region ; MODIFIER | silent_mutation | Average:42.772; most accessible tissue: Minghui63 panicle, score: 59.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107608673 | NA | 2.78E-80 | mr1134 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 7.89E-78 | mr1135 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 3.67E-27 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 5.95E-23 | mr1375 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 1.46E-88 | mr1504 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 2.64E-86 | mr1517 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 2.54E-69 | mr1538 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 1.22E-81 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 3.77E-16 | mr1416_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 1.86E-85 | mr1504_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | 2.22E-07 | NA | mr1517_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 7.00E-06 | mr1517_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | 5.52E-08 | 2.85E-108 | mr1538_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107608673 | NA | 1.68E-36 | mr1541_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |