RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0107540423:

Variant ID: vg0107540423 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7540423
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAGTCACATTACCTTAATTATTTCTAGTCTTTTAATGATAGATATATAGTTCAAATTGTCTTTTCTTTCTTCTCTCTTAAAAACATGCAATCTCAATTA[C/T]
TTTTAGCTCAAAATTATATCAAATTGTTTTAATTTTGTACGTATTATGTAACTTAATTTTCTACAGCAACGCGACCAGATGTTCATATAGTATCTTATAA

Reverse complement sequence

TTATAAGATACTATATGAACATCTGGTCGCGTTGCTGTAGAAAATTAAGTTACATAATACGTACAAAATTAAAACAATTTGATATAATTTTGAGCTAAAA[G/A]
TAATTGAGATTGCATGTTTTTAAGAGAGAAGAAAGAAAAGACAATTTGAACTATATATCTATCATTAAAAGACTAGAAATAATTAAGGTAATGTGACTTA

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.10%	6.80%	0.11%	0.00%	NA
All Indica	2759	99.90%	0.10%	0.00%	0.00%	NA
All Japonica	1512	79.20%	20.50%	0.33%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	98.30%	1.60%	0.13%	0.00%	NA
Tropical Japonica	504	46.60%	52.60%	0.79%	0.00%	NA
Japonica Intermediate	241	86.30%	13.70%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107540423	C -> T	LOC_Os01g13510.1	upstream_gene_variant ; 3248.0bp to feature; MODIFIER	silent_mutation	Average:33.976; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N
vg0107540423	C -> T	LOC_Os01g13500-LOC_Os01g13510	intergenic_region ; MODIFIER	silent_mutation	Average:33.976; most accessible tissue: Zhenshan97 flower, score: 43.307	N	N	N	N

Showing 1 to 2 of 2 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107540423	NA	5.64E-06	mr1213	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107540423	NA	5.46E-07	mr1403	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107540423	NA	1.59E-14	mr1410	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107540423	NA	9.94E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107540423	NA	6.39E-07	mr1693	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107540423	NA	1.56E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107540423	NA	5.68E-15	mr1410_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107540423	NA	5.00E-07	mr1668_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 8 of 8 entries

Previous1Next

Search for Variation information by Variation ID:

Detailed information for vg0107540423:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact