Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107527372:

Variant ID: vg0107527372 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7527372
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CAGCGGCAATAGCTTCAGGCGTCGAGAGGCCGGGGGAGAGAAGTTTAATGGAGGTGGAGATGGAGCACGGCGAGGAGGTGGCGGCGATGGAGGAGGAGCT[G/A]
AAGGGGTGGGACACGCCGAGGAGGGAGGAGTGCCGCATCCCGGTGGCCACAATGACGATGGACAGCGACCCCTCCTCCTCCTCCTCCTCCTCCGGCGAGT

Reverse complement sequence

ACTCGCCGGAGGAGGAGGAGGAGGAGGAGGGGTCGCTGTCCATCGTCATTGTGGCCACCGGGATGCGGCACTCCTCCCTCCTCGGCGTGTCCCACCCCTT[C/T]
AGCTCCTCCTCCATCGCCGCCACCTCCTCGCCGTGCTCCATCTCCACCTCCATTAAACTTCTCTCCCCCGGCCTCTCGACGCCTGAAGCTATTGCCGCTG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 44.40% 0.30% 0.00% NA
All Indica  2759 91.40% 8.20% 0.43% 0.00% NA
All Japonica  1512 3.10% 96.80% 0.07% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 97.00% 2.70% 0.34% 0.00% NA
Indica II  465 89.50% 10.10% 0.43% 0.00% NA
Indica III  913 89.60% 10.20% 0.22% 0.00% NA
Indica Intermediate  786 90.30% 8.90% 0.76% 0.00% NA
Temperate Japonica  767 2.50% 97.40% 0.13% 0.00% NA
Tropical Japonica  504 4.80% 95.20% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 98.30% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107527372 G -> A LOC_Os01g13500.1 upstream_gene_variant ; 1277.0bp to feature; MODIFIER silent_mutation Average:89.515; most accessible tissue: Zhenshan97 flag leaf, score: 95.89 N N N N
vg0107527372 G -> A LOC_Os01g13490.1 downstream_gene_variant ; 2939.0bp to feature; MODIFIER silent_mutation Average:89.515; most accessible tissue: Zhenshan97 flag leaf, score: 95.89 N N N N
vg0107527372 G -> A LOC_Os01g13490-LOC_Os01g13500 intergenic_region ; MODIFIER silent_mutation Average:89.515; most accessible tissue: Zhenshan97 flag leaf, score: 95.89 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107527372 G A -0.12 -0.09 -0.08 -0.09 -0.11 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107527372 NA 8.60E-47 mr1109 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 4.90E-36 mr1129 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 2.65E-21 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 5.69E-29 mr1208 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 1.53E-24 mr1251 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 1.14E-30 mr1257 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 1.57E-09 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 1.40E-06 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 1.02E-36 mr1435 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 6.74E-43 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 3.47E-08 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 1.23E-24 mr1537 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 2.30E-24 mr1551 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 5.58E-09 mr1610 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 2.15E-09 mr1663 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 2.39E-17 mr1700 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 4.34E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 1.23E-30 mr1745 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 7.41E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 5.80E-17 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 3.22E-08 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 4.10E-12 mr1914 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 4.45E-15 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 5.09E-07 1.15E-67 mr1970 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 3.97E-06 NA mr1970 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 2.28E-49 mr1063_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 2.46E-36 mr1208_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 1.60E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 1.44E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107527372 NA 3.39E-61 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251