\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107459962:

Variant ID: vg0107459962 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7459962
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTATTGGTAATGCTGTTGCTGAATGTATTATGAACAACGGCAAAAAACATTAGACTGGTACTCCCTCCGTCCTAAAATAAAATCATTTTTGGCTTCATC[C/T]
ATTTATTCCAAAATAAGTTTATTTTTAAGCAAGTAGAGGATAAATGCATTAGGAATAGATAAATTGAGAAATAATTACATTGATATTTGATTGAGGGTAT

Reverse complement sequence

ATACCCTCAATCAAATATCAATGTAATTATTTCTCAATTTATCTATTCCTAATGCATTTATCCTCTACTTGCTTAAAAATAAACTTATTTTGGAATAAAT[G/A]
GATGAAGCCAAAAATGATTTTATTTTAGGACGGAGGGAGTACCAGTCTAATGTTTTTTGCCGTTGTTCATAATACATTCAGCAACAGCATTACCAATAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 5.90% 0.74% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 80.00% 17.80% 2.25% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 66.40% 29.90% 3.78% 0.00% NA
Tropical Japonica  504 98.80% 0.80% 0.40% 0.00% NA
Japonica Intermediate  241 83.80% 14.90% 1.24% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107459962 C -> T LOC_Os01g13380.1 upstream_gene_variant ; 3872.0bp to feature; MODIFIER silent_mutation Average:49.382; most accessible tissue: Callus, score: 73.461 N N N N
vg0107459962 C -> T LOC_Os01g13390.1 downstream_gene_variant ; 3.0bp to feature; MODIFIER silent_mutation Average:49.382; most accessible tissue: Callus, score: 73.461 N N N N
vg0107459962 C -> T LOC_Os01g13404.1 downstream_gene_variant ; 386.0bp to feature; MODIFIER silent_mutation Average:49.382; most accessible tissue: Callus, score: 73.461 N N N N
vg0107459962 C -> T LOC_Os01g13404.2 downstream_gene_variant ; 388.0bp to feature; MODIFIER silent_mutation Average:49.382; most accessible tissue: Callus, score: 73.461 N N N N
vg0107459962 C -> T LOC_Os01g13404.3 downstream_gene_variant ; 398.0bp to feature; MODIFIER silent_mutation Average:49.382; most accessible tissue: Callus, score: 73.461 N N N N
vg0107459962 C -> T LOC_Os01g13390-LOC_Os01g13404 intergenic_region ; MODIFIER silent_mutation Average:49.382; most accessible tissue: Callus, score: 73.461 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107459962 NA 2.99E-19 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107459962 NA 1.38E-10 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107459962 NA 5.82E-12 Heading_date All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107459962 NA 3.58E-11 Heading_date Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107459962 NA 2.42E-11 mr1624 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 5.31E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 4.19E-07 mr1263_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 3.09E-08 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 7.27E-06 mr1577_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 1.07E-13 mr1624_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 3.11E-08 mr1624_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 1.49E-06 NA mr1713_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 7.53E-07 mr1723_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 2.04E-06 mr1729_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 3.57E-07 NA mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 3.91E-07 mr1736_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 3.40E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 3.14E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107459962 NA 8.90E-09 mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251