\
| Variant ID: vg0107459962 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7459962 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
ATTATTGGTAATGCTGTTGCTGAATGTATTATGAACAACGGCAAAAAACATTAGACTGGTACTCCCTCCGTCCTAAAATAAAATCATTTTTGGCTTCATC[C/T]
ATTTATTCCAAAATAAGTTTATTTTTAAGCAAGTAGAGGATAAATGCATTAGGAATAGATAAATTGAGAAATAATTACATTGATATTTGATTGAGGGTAT
ATACCCTCAATCAAATATCAATGTAATTATTTCTCAATTTATCTATTCCTAATGCATTTATCCTCTACTTGCTTAAAAATAAACTTATTTTGGAATAAAT[G/A]
GATGAAGCCAAAAATGATTTTATTTTAGGACGGAGGGAGTACCAGTCTAATGTTTTTTGCCGTTGTTCATAATACATTCAGCAACAGCATTACCAATAAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 5.90% | 0.74% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 80.00% | 17.80% | 2.25% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 66.40% | 29.90% | 3.78% | 0.00% | NA |
| Tropical Japonica | 504 | 98.80% | 0.80% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 83.80% | 14.90% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107459962 | C -> T | LOC_Os01g13380.1 | upstream_gene_variant ; 3872.0bp to feature; MODIFIER | silent_mutation | Average:49.382; most accessible tissue: Callus, score: 73.461 | N | N | N | N |
| vg0107459962 | C -> T | LOC_Os01g13390.1 | downstream_gene_variant ; 3.0bp to feature; MODIFIER | silent_mutation | Average:49.382; most accessible tissue: Callus, score: 73.461 | N | N | N | N |
| vg0107459962 | C -> T | LOC_Os01g13404.1 | downstream_gene_variant ; 386.0bp to feature; MODIFIER | silent_mutation | Average:49.382; most accessible tissue: Callus, score: 73.461 | N | N | N | N |
| vg0107459962 | C -> T | LOC_Os01g13404.2 | downstream_gene_variant ; 388.0bp to feature; MODIFIER | silent_mutation | Average:49.382; most accessible tissue: Callus, score: 73.461 | N | N | N | N |
| vg0107459962 | C -> T | LOC_Os01g13404.3 | downstream_gene_variant ; 398.0bp to feature; MODIFIER | silent_mutation | Average:49.382; most accessible tissue: Callus, score: 73.461 | N | N | N | N |
| vg0107459962 | C -> T | LOC_Os01g13390-LOC_Os01g13404 | intergenic_region ; MODIFIER | silent_mutation | Average:49.382; most accessible tissue: Callus, score: 73.461 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107459962 | NA | 2.99E-19 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0107459962 | NA | 1.38E-10 | Awn_length | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0107459962 | NA | 5.82E-12 | Heading_date | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0107459962 | NA | 3.58E-11 | Heading_date | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0107459962 | NA | 2.42E-11 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 5.31E-07 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 4.19E-07 | mr1263_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 3.09E-08 | mr1263_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 7.27E-06 | mr1577_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 1.07E-13 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 3.11E-08 | mr1624_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | 1.49E-06 | NA | mr1713_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 7.53E-07 | mr1723_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 2.04E-06 | mr1729_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | 3.57E-07 | NA | mr1733_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 3.91E-07 | mr1736_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 3.40E-06 | mr1740_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 3.14E-09 | mr1741_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107459962 | NA | 8.90E-09 | mr1829_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |