\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107367191:

Variant ID: vg0107367191 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7367191
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTCAACTAAATATCAATTGATTTTTTTTGCTAAATAGCATTAACTAATATATCACTATCCGAATTGTTCTAGATTTCTTTATATAGATCGAGAAAAAA[T/A]
ACGTGCGATCACATCACGAGTACAATATGTTAACACGCCATTTAAAATTTCACCTTTGTCATCGGCTATAACTACCTACACATTAACACACACCCTTGCC

Reverse complement sequence

GGCAAGGGTGTGTGTTAATGTGTAGGTAGTTATAGCCGATGACAAAGGTGAAATTTTAAATGGCGTGTTAACATATTGTACTCGTGATGTGATCGCACGT[A/T]
TTTTTTCTCGATCTATATAAAGAAATCTAGAACAATTCGGATAGTGATATATTAGTTAATGCTATTTAGCAAAAAAAATCAATTGATATTTAGTTGAATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.80% 44.00% 0.28% 0.00% NA
All Indica  2759 92.00% 7.60% 0.40% 0.00% NA
All Japonica  1512 3.20% 96.80% 0.00% 0.00% NA
Aus  269 0.00% 100.00% 0.00% 0.00% NA
Indica I  595 96.30% 3.20% 0.50% 0.00% NA
Indica II  465 89.90% 9.50% 0.65% 0.00% NA
Indica III  913 91.30% 8.70% 0.00% 0.00% NA
Indica Intermediate  786 90.80% 8.50% 0.64% 0.00% NA
Temperate Japonica  767 2.50% 97.50% 0.00% 0.00% NA
Tropical Japonica  504 5.00% 95.00% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 48.90% 48.90% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107367191 T -> A LOC_Os01g13210.1 upstream_gene_variant ; 1080.0bp to feature; MODIFIER silent_mutation Average:98.445; most accessible tissue: Callus, score: 99.697 N N N N
vg0107367191 T -> A LOC_Os01g13210.2 upstream_gene_variant ; 1080.0bp to feature; MODIFIER silent_mutation Average:98.445; most accessible tissue: Callus, score: 99.697 N N N N
vg0107367191 T -> A LOC_Os01g13229.1 downstream_gene_variant ; 2481.0bp to feature; MODIFIER silent_mutation Average:98.445; most accessible tissue: Callus, score: 99.697 N N N N
vg0107367191 T -> A LOC_Os01g13210-LOC_Os01g13229 intergenic_region ; MODIFIER silent_mutation Average:98.445; most accessible tissue: Callus, score: 99.697 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107367191 T A 0.01 0.0 -0.01 0.01 0.02 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107367191 NA 2.28E-20 mr1179 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 3.91E-42 mr1458 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 9.38E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 3.12E-06 3.05E-06 mr1486 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 6.50E-06 5.60E-06 mr1548 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 1.21E-10 mr1720 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 1.15E-16 mr1825 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 3.28E-07 mr1836 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 1.16E-17 mr1913 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 1.88E-64 mr1970 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 5.86E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 1.74E-47 mr1458_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 8.88E-06 NA mr1486_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 9.35E-07 1.41E-07 mr1486_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 5.94E-06 NA mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 6.82E-06 NA mr1588_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 2.86E-15 mr1720_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107367191 NA 5.10E-61 mr1970_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251