Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107324822:

Variant ID: vg0107324822 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7324822
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTAACATATAAATTTCAAATCGATTATGAATGGATATGATATTTATGGCCTGTTTAAGAAGCTTAAAATTCTGAAAAGCAGCTAGTAGATAATAAACTT[C/A]
TAAGAATCTAGTAAAACTGGGTTTCTCAGCTTCTGGCTTCTAGTTCATTTTCTGGATTCTATAACTACATCTTCAAAGAATCTGGACAAAAACTAAATTT

Reverse complement sequence

AAATTTAGTTTTTGTCCAGATTCTTTGAAGATGTAGTTATAGAATCCAGAAAATGAACTAGAAGCCAGAAGCTGAGAAACCCAGTTTTACTAGATTCTTA[G/T]
AAGTTTATTATCTACTAGCTGCTTTTCAGAATTTTAAGCTTCTTAAACAGGCCATAAATATCATATCCATTCATAATCGATTTGAAATTTATATGTTAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 46.40% 0.40% 0.00% NA
All Indica  2759 25.30% 74.20% 0.51% 0.00% NA
All Japonica  1512 93.30% 6.60% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 15.60% 83.70% 0.67% 0.00% NA
Indica II  465 9.70% 90.30% 0.00% 0.00% NA
Indica III  913 34.60% 65.10% 0.33% 0.00% NA
Indica Intermediate  786 31.00% 68.10% 0.89% 0.00% NA
Temperate Japonica  767 97.70% 2.30% 0.00% 0.00% NA
Tropical Japonica  504 84.30% 15.70% 0.00% 0.00% NA
Japonica Intermediate  241 97.90% 1.20% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 50.00% 46.70% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107324822 C -> A LOC_Os01g13150.1 upstream_gene_variant ; 323.0bp to feature; MODIFIER silent_mutation Average:77.671; most accessible tissue: Callus, score: 95.648 N N N N
vg0107324822 C -> A LOC_Os01g13140-LOC_Os01g13150 intergenic_region ; MODIFIER silent_mutation Average:77.671; most accessible tissue: Callus, score: 95.648 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107324822 C A -0.01 -0.02 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107324822 NA 1.05E-06 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107324822 NA 6.69E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107324822 NA 8.65E-09 mr1465 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107324822 2.92E-06 NA mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107324822 3.19E-06 7.70E-07 mr1707 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107324822 NA 5.55E-06 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251