Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0107281602:

Variant ID: vg0107281602 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7281602
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGAGACAAATTTATTAAATCTAATTAATCCGTCATTAGTAAATGTTTATGGTAGTACAACATTGTCAAATCATGACGTAATTAGCTCGCGATTTACATG[T/C]
AAATTGTGTAATAGGTTTTTTTTCTATATTTATTACTCCATACATATGTCCAAATATTCGATGTGACGGAAAAAGTTATAAGTTGAAAGAAAAAAAGTTT

Reverse complement sequence

AAACTTTTTTTCTTTCAACTTATAACTTTTTCCGTCACATCGAATATTTGGACATATGTATGGAGTAATAAATATAGAAAAAAAACCTATTACACAATTT[A/G]
CATGTAAATCGCGAGCTAATTACGTCATGATTTGACAATGTTGTACTACCATAAACATTTACTAATGACGGATTAATTAGATTTAATAAATTTGTCTCAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.40%	46.60%	1.71%	0.23%	NA
All Indica	2759	70.30%	29.10%	0.25%	0.40%	NA
All Japonica	1512	29.40%	66.10%	4.50%	0.00%	NA
Aus	269	0.40%	99.60%	0.00%	0.00%	NA
Indica I	595	84.70%	14.10%	0.84%	0.34%	NA
Indica II	465	88.80%	11.20%	0.00%	0.00%	NA
Indica III	913	61.20%	38.30%	0.11%	0.33%	NA
Indica Intermediate	786	58.90%	40.20%	0.13%	0.76%	NA
Temperate Japonica	767	42.10%	50.70%	7.17%	0.00%	NA
Tropical Japonica	504	19.00%	80.00%	0.99%	0.00%	NA
Japonica Intermediate	241	10.40%	86.30%	3.32%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	48.90%	44.40%	6.67%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107281602	T -> DEL	N	N	silent_mutation	Average:77.556; most accessible tissue: Minghui63 root, score: 92.642	N	N	N	N
vg0107281602	T -> C	LOC_Os01g13080.1	upstream_gene_variant ; 1352.0bp to feature; MODIFIER	silent_mutation	Average:77.556; most accessible tissue: Minghui63 root, score: 92.642	N	N	N	N
vg0107281602	T -> C	LOC_Os01g13090.1	upstream_gene_variant ; 132.0bp to feature; MODIFIER	silent_mutation	Average:77.556; most accessible tissue: Minghui63 root, score: 92.642	N	N	N	N
vg0107281602	T -> C	LOC_Os01g13090.2	upstream_gene_variant ; 132.0bp to feature; MODIFIER	silent_mutation	Average:77.556; most accessible tissue: Minghui63 root, score: 92.642	N	N	N	N
vg0107281602	T -> C	LOC_Os01g13090.3	upstream_gene_variant ; 132.0bp to feature; MODIFIER	silent_mutation	Average:77.556; most accessible tissue: Minghui63 root, score: 92.642	N	N	N	N
vg0107281602	T -> C	LOC_Os01g13090.4	upstream_gene_variant ; 132.0bp to feature; MODIFIER	silent_mutation	Average:77.556; most accessible tissue: Minghui63 root, score: 92.642	N	N	N	N
vg0107281602	T -> C	LOC_Os01g13070.1	downstream_gene_variant ; 3630.0bp to feature; MODIFIER	silent_mutation	Average:77.556; most accessible tissue: Minghui63 root, score: 92.642	N	N	N	N
vg0107281602	T -> C	LOC_Os01g13080-LOC_Os01g13090	intergenic_region ; MODIFIER	silent_mutation	Average:77.556; most accessible tissue: Minghui63 root, score: 92.642	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0107281602	T	C	-0.01	0.0	0.0	-0.02	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107281602	NA	7.41E-22	Plant_height	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107281602	NA	2.92E-06	mr1010	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602	NA	9.71E-09	mr1057	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602	NA	1.77E-07	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602	NA	4.85E-12	mr1465	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602	NA	7.27E-12	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602	NA	7.16E-09	mr1669	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602	NA	1.88E-07	mr1051_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602	NA	1.37E-07	mr1057_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602	NA	3.36E-10	mr1164_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602	NA	1.13E-07	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602	NA	2.75E-06	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251