\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107281602:

Variant ID: vg0107281602 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7281602
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTGAGACAAATTTATTAAATCTAATTAATCCGTCATTAGTAAATGTTTATGGTAGTACAACATTGTCAAATCATGACGTAATTAGCTCGCGATTTACATG[T/C]
AAATTGTGTAATAGGTTTTTTTTCTATATTTATTACTCCATACATATGTCCAAATATTCGATGTGACGGAAAAAGTTATAAGTTGAAAGAAAAAAAGTTT

Reverse complement sequence

AAACTTTTTTTCTTTCAACTTATAACTTTTTCCGTCACATCGAATATTTGGACATATGTATGGAGTAATAAATATAGAAAAAAAACCTATTACACAATTT[A/G]
CATGTAAATCGCGAGCTAATTACGTCATGATTTGACAATGTTGTACTACCATAAACATTTACTAATGACGGATTAATTAGATTTAATAAATTTGTCTCAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.40% 46.60% 1.71% 0.23% NA
All Indica  2759 70.30% 29.10% 0.25% 0.40% NA
All Japonica  1512 29.40% 66.10% 4.50% 0.00% NA
Aus  269 0.40% 99.60% 0.00% 0.00% NA
Indica I  595 84.70% 14.10% 0.84% 0.34% NA
Indica II  465 88.80% 11.20% 0.00% 0.00% NA
Indica III  913 61.20% 38.30% 0.11% 0.33% NA
Indica Intermediate  786 58.90% 40.20% 0.13% 0.76% NA
Temperate Japonica  767 42.10% 50.70% 7.17% 0.00% NA
Tropical Japonica  504 19.00% 80.00% 0.99% 0.00% NA
Japonica Intermediate  241 10.40% 86.30% 3.32% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 48.90% 44.40% 6.67% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107281602 T -> DEL N N silent_mutation Average:77.556; most accessible tissue: Minghui63 root, score: 92.642 N N N N
vg0107281602 T -> C LOC_Os01g13080.1 upstream_gene_variant ; 1352.0bp to feature; MODIFIER silent_mutation Average:77.556; most accessible tissue: Minghui63 root, score: 92.642 N N N N
vg0107281602 T -> C LOC_Os01g13090.1 upstream_gene_variant ; 132.0bp to feature; MODIFIER silent_mutation Average:77.556; most accessible tissue: Minghui63 root, score: 92.642 N N N N
vg0107281602 T -> C LOC_Os01g13090.2 upstream_gene_variant ; 132.0bp to feature; MODIFIER silent_mutation Average:77.556; most accessible tissue: Minghui63 root, score: 92.642 N N N N
vg0107281602 T -> C LOC_Os01g13090.3 upstream_gene_variant ; 132.0bp to feature; MODIFIER silent_mutation Average:77.556; most accessible tissue: Minghui63 root, score: 92.642 N N N N
vg0107281602 T -> C LOC_Os01g13090.4 upstream_gene_variant ; 132.0bp to feature; MODIFIER silent_mutation Average:77.556; most accessible tissue: Minghui63 root, score: 92.642 N N N N
vg0107281602 T -> C LOC_Os01g13070.1 downstream_gene_variant ; 3630.0bp to feature; MODIFIER silent_mutation Average:77.556; most accessible tissue: Minghui63 root, score: 92.642 N N N N
vg0107281602 T -> C LOC_Os01g13080-LOC_Os01g13090 intergenic_region ; MODIFIER silent_mutation Average:77.556; most accessible tissue: Minghui63 root, score: 92.642 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107281602 T C -0.01 0.0 0.0 -0.02 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107281602 NA 7.41E-22 Plant_height All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0107281602 NA 2.92E-06 mr1010 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602 NA 9.71E-09 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602 NA 1.77E-07 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602 NA 4.85E-12 mr1465 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602 NA 7.27E-12 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602 NA 7.16E-09 mr1669 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602 NA 1.88E-07 mr1051_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602 NA 1.37E-07 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602 NA 3.36E-10 mr1164_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602 NA 1.13E-07 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107281602 NA 2.75E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251