Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107259201:

Variant ID: vg0107259201 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7259201
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGCAAAACCCCCAATCTCGCCTGCTACGGAGATCTCGCGAACTGGTAGTCACTGATATGTAGGTCAGGCTAACGACGGCAACATTACTGATCTACTCCCT[C/T]
TGTCTCGAAATATAAGCACTTTTATTATAGTGTCAAGTCAACTATTTTTAACTTTGACTATTAATAGCAAAAAAAAAATCAAAAAAATCAATAATGTAAA

Reverse complement sequence

TTTACATTATTGATTTTTTTGATTTTTTTTTTGCTATTAATAGTCAAAGTTAAAAATAGTTGACTTGACACTATAATAAAAGTGCTTATATTTCGAGACA[G/A]
AGGGAGTAGATCAGTAATGTTGCCGTCGTTAGCCTGACCTACATATCAGTGACTACCAGTTCGCGAGATCTCCGTAGCAGGCGAGATTGGGGGTTTTGCA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.90%	44.60%	0.15%	0.30%	NA
All Indica	2759	76.40%	22.90%	0.18%	0.51%	NA
All Japonica	1512	8.10%	91.90%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	84.70%	14.80%	0.17%	0.34%	NA
Indica II	465	96.60%	3.00%	0.43%	0.00%	NA
Indica III	913	69.10%	30.20%	0.00%	0.66%	NA
Indica Intermediate	786	66.80%	32.20%	0.25%	0.76%	NA
Temperate Japonica	767	2.30%	97.70%	0.00%	0.00%	NA
Tropical Japonica	504	19.40%	80.60%	0.00%	0.00%	NA
Japonica Intermediate	241	2.50%	97.50%	0.00%	0.00%	NA
VI/Aromatic	96	47.90%	52.10%	0.00%	0.00%	NA
Intermediate	90	56.70%	41.10%	2.22%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107259201	C -> T	LOC_Os01g13040.1	upstream_gene_variant ; 585.0bp to feature; MODIFIER	silent_mutation	Average:67.801; most accessible tissue: Zhenshan97 root, score: 96.46	N	N	N	N
vg0107259201	C -> T	LOC_Os01g13050.1	upstream_gene_variant ; 3821.0bp to feature; MODIFIER	silent_mutation	Average:67.801; most accessible tissue: Zhenshan97 root, score: 96.46	N	N	N	N
vg0107259201	C -> T	LOC_Os01g13030.1	downstream_gene_variant ; 4572.0bp to feature; MODIFIER	silent_mutation	Average:67.801; most accessible tissue: Zhenshan97 root, score: 96.46	N	N	N	N
vg0107259201	C -> T	LOC_Os01g13030-LOC_Os01g13040	intergenic_region ; MODIFIER	silent_mutation	Average:67.801; most accessible tissue: Zhenshan97 root, score: 96.46	N	N	N	N
vg0107259201	C -> DEL	N	N	silent_mutation	Average:67.801; most accessible tissue: Zhenshan97 root, score: 96.46	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0107259201	C	T	-0.02	-0.02	-0.02	-0.03	-0.03	-0.06

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107259201	NA	7.46E-06	mr1200	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201	NA	6.49E-10	mr1291	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201	NA	2.05E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201	NA	6.75E-11	mr1471	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201	NA	2.92E-17	mr1557	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201	NA	5.54E-11	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201	NA	1.55E-07	mr1815	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201	NA	8.36E-06	mr1121_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201	NA	7.83E-06	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201	NA	1.39E-06	mr1653_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201	NA	2.53E-07	mr1699_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251