\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107259201:

Variant ID: vg0107259201 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7259201
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGCAAAACCCCCAATCTCGCCTGCTACGGAGATCTCGCGAACTGGTAGTCACTGATATGTAGGTCAGGCTAACGACGGCAACATTACTGATCTACTCCCT[C/T]
TGTCTCGAAATATAAGCACTTTTATTATAGTGTCAAGTCAACTATTTTTAACTTTGACTATTAATAGCAAAAAAAAAATCAAAAAAATCAATAATGTAAA

Reverse complement sequence

TTTACATTATTGATTTTTTTGATTTTTTTTTTGCTATTAATAGTCAAAGTTAAAAATAGTTGACTTGACACTATAATAAAAGTGCTTATATTTCGAGACA[G/A]
AGGGAGTAGATCAGTAATGTTGCCGTCGTTAGCCTGACCTACATATCAGTGACTACCAGTTCGCGAGATCTCCGTAGCAGGCGAGATTGGGGGTTTTGCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.90% 44.60% 0.15% 0.30% NA
All Indica  2759 76.40% 22.90% 0.18% 0.51% NA
All Japonica  1512 8.10% 91.90% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 84.70% 14.80% 0.17% 0.34% NA
Indica II  465 96.60% 3.00% 0.43% 0.00% NA
Indica III  913 69.10% 30.20% 0.00% 0.66% NA
Indica Intermediate  786 66.80% 32.20% 0.25% 0.76% NA
Temperate Japonica  767 2.30% 97.70% 0.00% 0.00% NA
Tropical Japonica  504 19.40% 80.60% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 47.90% 52.10% 0.00% 0.00% NA
Intermediate  90 56.70% 41.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107259201 C -> T LOC_Os01g13040.1 upstream_gene_variant ; 585.0bp to feature; MODIFIER silent_mutation Average:67.801; most accessible tissue: Zhenshan97 root, score: 96.46 N N N N
vg0107259201 C -> T LOC_Os01g13050.1 upstream_gene_variant ; 3821.0bp to feature; MODIFIER silent_mutation Average:67.801; most accessible tissue: Zhenshan97 root, score: 96.46 N N N N
vg0107259201 C -> T LOC_Os01g13030.1 downstream_gene_variant ; 4572.0bp to feature; MODIFIER silent_mutation Average:67.801; most accessible tissue: Zhenshan97 root, score: 96.46 N N N N
vg0107259201 C -> T LOC_Os01g13030-LOC_Os01g13040 intergenic_region ; MODIFIER silent_mutation Average:67.801; most accessible tissue: Zhenshan97 root, score: 96.46 N N N N
vg0107259201 C -> DEL N N silent_mutation Average:67.801; most accessible tissue: Zhenshan97 root, score: 96.46 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107259201 C T -0.02 -0.02 -0.02 -0.03 -0.03 -0.06

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107259201 NA 7.46E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201 NA 6.49E-10 mr1291 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201 NA 2.05E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201 NA 6.75E-11 mr1471 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201 NA 2.92E-17 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201 NA 5.54E-11 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201 NA 1.55E-07 mr1815 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201 NA 8.36E-06 mr1121_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201 NA 7.83E-06 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201 NA 1.39E-06 mr1653_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107259201 NA 2.53E-07 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251