\
| Variant ID: vg0107209160 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7209160 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGTTGTAAATGTTAGCCTACCTTACTAATGAAAAAAAAAATCCTTTAACCATCATACTCCTTGCCGTACTCCGCTCCCCCCCTTTTTTGAGTAAAGCTGC[A/G]
GAGATTTACTTTGCTCGGCGGAGCCAAAGTGGTCTCGACACGAGCTTGGCCACGGAGATTTACTTCGCTCGGCGAGGGCCGGAGAGGTCTCGATGATGGC
GCCATCATCGAGACCTCTCCGGCCCTCGCCGAGCGAAGTAAATCTCCGTGGCCAAGCTCGTGTCGAGACCACTTTGGCTCCGCCGAGCAAAGTAAATCTC[T/C]
GCAGCTTTACTCAAAAAAGGGGGGGAGCGGAGTACGGCAAGGAGTATGATGGTTAAAGGATTTTTTTTTTCATTAGTAAGGTAGGCTAACATTTACAACG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.90% | 27.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 18.80% | 81.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 48.00% | 52.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 77.10% | 22.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 25.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107209160 | A -> G | LOC_Os01g12950.1 | downstream_gene_variant ; 3461.0bp to feature; MODIFIER | silent_mutation | Average:62.645; most accessible tissue: Minghui63 root, score: 75.485 | N | N | N | N |
| vg0107209160 | A -> G | LOC_Os01g12950.4 | downstream_gene_variant ; 3477.0bp to feature; MODIFIER | silent_mutation | Average:62.645; most accessible tissue: Minghui63 root, score: 75.485 | N | N | N | N |
| vg0107209160 | A -> G | LOC_Os01g12950.3 | intron_variant ; MODIFIER | silent_mutation | Average:62.645; most accessible tissue: Minghui63 root, score: 75.485 | N | N | N | N |
| vg0107209160 | A -> G | LOC_Os01g12950.2 | intron_variant ; MODIFIER | silent_mutation | Average:62.645; most accessible tissue: Minghui63 root, score: 75.485 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107209160 | NA | 5.31E-57 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 2.74E-06 | mr1076 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 4.65E-06 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 5.49E-06 | NA | mr1083 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 3.07E-06 | 1.37E-08 | mr1083 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 4.77E-06 | NA | mr1085 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 4.78E-06 | 4.78E-06 | mr1204 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 5.15E-06 | NA | mr1226 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 2.82E-06 | mr1226 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 2.87E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 1.80E-84 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 1.92E-10 | mr1683 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 2.54E-14 | mr1909 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 2.81E-06 | mr1925 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 6.96E-06 | mr1949 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 1.89E-06 | 1.89E-06 | mr1076_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 9.20E-06 | NA | mr1083_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 5.83E-07 | mr1083_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 2.94E-08 | NA | mr1104_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 1.82E-06 | mr1104_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 1.74E-06 | NA | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 1.19E-08 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 1.52E-07 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 1.42E-28 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 2.70E-08 | NA | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 5.33E-09 | 8.50E-11 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 3.13E-66 | mr1733_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 3.38E-07 | NA | mr1925_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | 2.74E-07 | 2.75E-07 | mr1925_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107209160 | NA | 1.11E-18 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |