Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107208536:

Variant ID: vg0107208536 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7208536
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTAATGAAAAGCTCAGCTTTTGCCACTCTGTGCTCCCGGTCGTTCCGGCCCGTTCTGAACGCAGGTTCCAGCTTCCTCCTCCGCTCTAGCTCTCGCTCCG[A/G]
AGGTCGGTCGGAGGGAATTGCTGCCGACGATCGCTGTCGTGATGGCCGTGACTCCGAACGCGACCAGCCCTTCATTGCCTGCACCCGGAGTTGCTCAGCC

Reverse complement sequence

GGCTGAGCAACTCCGGGTGCAGGCAATGAAGGGCTGGTCGCGTTCGGAGTCACGGCCATCACGACAGCGATCGTCGGCAGCAATTCCCTCCGACCGACCT[T/C]
CGGAGCGAGAGCTAGAGCGGAGGAGGAAGCTGGAACCTGCGTTCAGAACGGGCCGGAACGACCGGGAGCACAGAGTGGCAAAAGCTGAGCTTTTCATTAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.10% 26.70% 0.17% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 19.60% 80.00% 0.40% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 99.40% 0.60% 0.00% 0.00% NA
Temperate Japonica  767 4.20% 95.00% 0.78% 0.00% NA
Tropical Japonica  504 48.20% 51.80% 0.00% 0.00% NA
Japonica Intermediate  241 8.70% 91.30% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 74.40% 23.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107208536 A -> G LOC_Os01g12950.1 downstream_gene_variant ; 2837.0bp to feature; MODIFIER silent_mutation Average:70.897; most accessible tissue: Callus, score: 83.662 N N N N
vg0107208536 A -> G LOC_Os01g12950.4 downstream_gene_variant ; 2853.0bp to feature; MODIFIER silent_mutation Average:70.897; most accessible tissue: Callus, score: 83.662 N N N N
vg0107208536 A -> G LOC_Os01g12950.3 intron_variant ; MODIFIER silent_mutation Average:70.897; most accessible tissue: Callus, score: 83.662 N N N N
vg0107208536 A -> G LOC_Os01g12950.2 intron_variant ; MODIFIER silent_mutation Average:70.897; most accessible tissue: Callus, score: 83.662 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107208536 NA 3.22E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 1.73E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 1.37E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 1.83E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 2.76E-06 2.76E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 7.36E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 8.28E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 1.41E-81 mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 4.55E-06 NA mr1878 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 2.91E-06 mr1878 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 9.10E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 2.39E-06 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 9.24E-06 NA mr1083_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 1.48E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 3.64E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 2.10E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 2.12E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 2.70E-09 NA mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 6.15E-08 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 1.06E-09 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 2.58E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 3.15E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 9.72E-25 mr1588_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107208536 NA 2.11E-62 mr1733_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251