Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107188867:

Variant ID: vg0107188867 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7188867
Reference Allele: AAlternative Allele: C
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAATTATTGTTCAAGTTCATTTTTTACTTTCTATAAGTCCTGCCGAACCGTCAGCGGCTTTGCCATTGTACTCCTTTATGGCTCACCCGTTGTCTCCCTT[A/C]
TTTATTATCATTGAGATTTTAAAATCATACATGATTATCATTGGTTTTTTTTTACTTTTTAGAAGTTCCGAACCTTTAAAAATTGGACCTTGTAGTTTTT

Reverse complement sequence

AAAAACTACAAGGTCCAATTTTTAAAGGTTCGGAACTTCTAAAAAGTAAAAAAAAACCAATGATAATCATGTATGATTTTAAAATCTCAATGATAATAAA[T/G]
AAGGGAGACAACGGGTGAGCCATAAAGGAGTACAATGGCAAAGCCGCTGACGGTTCGGCAGGACTTATAGAAAGTAAAAAATGAACTTGAACAATAATTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 27.70% 0.00% 0.00% NA
All Indica  2759 98.70% 1.30% 0.00% 0.00% NA
All Japonica  1512 18.90% 81.10% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.50% 0.50% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.60% 0.00% 0.00% NA
Temperate Japonica  767 2.90% 97.10% 0.00% 0.00% NA
Tropical Japonica  504 48.00% 52.00% 0.00% 0.00% NA
Japonica Intermediate  241 9.10% 90.90% 0.00% 0.00% NA
VI/Aromatic  96 77.10% 22.90% 0.00% 0.00% NA
Intermediate  90 73.30% 26.70% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107188867 A -> C LOC_Os01g12930.1 upstream_gene_variant ; 4904.0bp to feature; MODIFIER silent_mutation Average:32.353; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0107188867 A -> C LOC_Os01g12940.1 upstream_gene_variant ; 829.0bp to feature; MODIFIER silent_mutation Average:32.353; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N
vg0107188867 A -> C LOC_Os01g12940-LOC_Os01g12950 intergenic_region ; MODIFIER silent_mutation Average:32.353; most accessible tissue: Zhenshan97 panicle, score: 49.416 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107188867 7.97E-06 NA mr1076 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 3.33E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 8.79E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 9.25E-08 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 1.09E-06 NA mr1085 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 6.25E-06 6.25E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 3.58E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 1.50E-14 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 3.29E-20 mr1838 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 3.91E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 7.00E-06 mr1949 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 2.53E-06 2.53E-06 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 6.95E-07 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 7.46E-08 NA mr1104_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 1.54E-06 mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 1.70E-07 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 NA 7.55E-08 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107188867 3.40E-06 2.65E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251