\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107157245:

Variant ID: vg0107157245 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7157245
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 259. )

Flanking Sequence (100 bp) in Reference Genome:


CAACACAAACAAACACAGAGAACACATAAACACAGAGGGGGCAATCAACTCTGTTGTTTGATCTATACTTCGTCAGAGTTTGATATATCTCTGCTCTCTG[C/T]
ATTTTAAAACTACTTATATTACAAAGCACTGTATGTTATATAGTAATACTTTGTAGATCACGAGTATAAAACACAGATAGGTACAATTTTTTTTACTCCT

Reverse complement sequence

AGGAGTAAAAAAAATTGTACCTATCTGTGTTTTATACTCGTGATCTACAAAGTATTACTATATAACATACAGTGCTTTGTAATATAAGTAGTTTTAAAAT[G/A]
CAGAGAGCAGAGATATATCAAACTCTGACGAAGTATAGATCAAACAACAGAGTTGATTGCCCCCTCTGTGTTTATGTGTTCTCTGTGTTTGTTTGTGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.50% 47.10% 0.17% 0.28% NA
All Indica  2759 29.60% 69.70% 0.22% 0.47% NA
All Japonica  1512 82.50% 17.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 9.40% 90.10% 0.34% 0.17% NA
Indica II  465 11.60% 88.20% 0.00% 0.22% NA
Indica III  913 41.10% 58.10% 0.22% 0.66% NA
Indica Intermediate  786 42.20% 56.90% 0.25% 0.64% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 54.00% 46.00% 0.00% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 57.80% 40.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107157245 C -> T LOC_Os01g12890.1 upstream_gene_variant ; 535.0bp to feature; MODIFIER silent_mutation Average:83.014; most accessible tissue: Callus, score: 98.548 N N N N
vg0107157245 C -> T LOC_Os01g12880-LOC_Os01g12890 intergenic_region ; MODIFIER silent_mutation Average:83.014; most accessible tissue: Callus, score: 98.548 N N N N
vg0107157245 C -> DEL N N silent_mutation Average:83.014; most accessible tissue: Callus, score: 98.548 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107157245 C T 0.02 0.02 0.02 0.01 0.01 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107157245 NA 2.22E-06 mr1200 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 NA 8.32E-22 mr1244 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 NA 2.23E-06 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 NA 6.26E-10 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 4.64E-07 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 1.96E-06 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 NA 1.06E-08 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 NA 9.89E-08 mr1126_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 NA 8.40E-08 mr1200_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 NA 1.69E-27 mr1244_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 NA 1.14E-16 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 1.25E-10 1.94E-09 mr1498_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 2.04E-09 2.10E-11 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 7.96E-08 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 NA 3.65E-09 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 4.60E-08 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 3.79E-08 4.94E-09 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107157245 4.30E-06 NA mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251