\
| Variant ID: vg0107138425 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7138425 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TTTTCATTGTTGTTAGATGATAAAACATGATTAATACTTTATGCATGTCTTATCTTTTTAATTTTTTTTAAATAAGACGGAGGGTCAAACGTTGGACACG[A/G]
AAACCCAGGGTTTGTCTTTTTTTTAGGACAGAGGGATTACGTAGCAAGACTATTTACGACCTTTTTATCCATACATCCACGATAGGAACTTGCAACTGGA
TCCAGTTGCAAGTTCCTATCGTGGATGTATGGATAAAAAGGTCGTAAATAGTCTTGCTACGTAATCCCTCTGTCCTAAAAAAAAGACAAACCCTGGGTTT[T/C]
CGTGTCCAACGTTTGACCCTCCGTCTTATTTAAAAAAAATTAAAAAGATAAGACATGCATAAAGTATTAATCATGTTTTATCATCTAACAACAATGAAAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.40% | 28.30% | 0.15% | 0.17% | NA |
| All Indica | 2759 | 97.40% | 2.10% | 0.22% | 0.29% | NA |
| All Japonica | 1512 | 18.50% | 81.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.70% | 0.00% | 0.17% | NA |
| Indica II | 465 | 99.40% | 0.40% | 0.00% | 0.22% | NA |
| Indica III | 913 | 97.80% | 1.20% | 0.44% | 0.55% | NA |
| Indica Intermediate | 786 | 94.40% | 5.20% | 0.25% | 0.13% | NA |
| Temperate Japonica | 767 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 48.00% | 52.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 8.70% | 91.30% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 78.10% | 21.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 70.00% | 28.90% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107138425 | A -> G | LOC_Os01g12880.1 | downstream_gene_variant ; 1095.0bp to feature; MODIFIER | silent_mutation | Average:77.038; most accessible tissue: Zhenshan97 flower, score: 88.302 | N | N | N | N |
| vg0107138425 | A -> G | LOC_Os01g12880-LOC_Os01g12890 | intergenic_region ; MODIFIER | silent_mutation | Average:77.038; most accessible tissue: Zhenshan97 flower, score: 88.302 | N | N | N | N |
| vg0107138425 | A -> DEL | N | N | silent_mutation | Average:77.038; most accessible tissue: Zhenshan97 flower, score: 88.302 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107138425 | NA | 4.23E-09 | mr1005 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | NA | 4.29E-58 | mr1019 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | NA | 7.47E-07 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | NA | 2.69E-07 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | NA | 3.69E-09 | mr1575 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | NA | 1.69E-14 | mr1653 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | NA | 9.55E-84 | mr1672 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | NA | 4.84E-40 | mr1243_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | 5.60E-08 | NA | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | 4.34E-09 | 3.76E-11 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | NA | 6.64E-25 | mr1653_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | NA | 7.63E-69 | mr1733_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107138425 | NA | 1.07E-09 | mr1947_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |