Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107138250:

Variant ID: vg0107138250 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7138250
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CCCTCATAATATAACAAATCTGGGCATCCATTTGTCCAGAGTCATTATACTAGGAGTAACATCATCTTCTAAGTTTTTTTTTGGGGAGTACTCTCTCCGT[C/T]
CCAAAAAATAAACCCTAGGTTTCCGTGTCCAACGTTTGACTGTTTGTCTTATATAATTTTTTTTATAATTAGTATTTTCATTGTTGTTAGATGATAAAAC

Reverse complement sequence

GTTTTATCATCTAACAACAATGAAAATACTAATTATAAAAAAAATTATATAAGACAAACAGTCAAACGTTGGACACGGAAACCTAGGGTTTATTTTTTGG[G/A]
ACGGAGAGAGTACTCCCCAAAAAAAAACTTAGAAGATGATGTTACTCCTAGTATAATGACTCTGGACAAATGGATGCCCAGATTTGTTATATTATGAGGG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	81.90%	17.60%	0.17%	0.38%	NA
All Indica	2759	70.00%	29.10%	0.25%	0.65%	NA
All Japonica	1512	99.60%	0.40%	0.00%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	91.80%	7.60%	0.50%	0.17%	NA
Indica II	465	65.40%	34.40%	0.22%	0.00%	NA
Indica III	913	66.60%	32.10%	0.22%	1.10%	NA
Indica Intermediate	786	60.30%	38.70%	0.13%	0.89%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	82.20%	16.70%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107138250	C -> T	LOC_Os01g12880.1	downstream_gene_variant ; 920.0bp to feature; MODIFIER	silent_mutation	Average:63.781; most accessible tissue: Minghui63 flower, score: 73.172	N	N	N	N
vg0107138250	C -> T	LOC_Os01g12880-LOC_Os01g12890	intergenic_region ; MODIFIER	silent_mutation	Average:63.781; most accessible tissue: Minghui63 flower, score: 73.172	N	N	N	N
vg0107138250	C -> DEL	N	N	silent_mutation	Average:63.781; most accessible tissue: Minghui63 flower, score: 73.172	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107138250	NA	5.24E-08	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107138250	6.39E-07	NA	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107138250	1.14E-06	2.04E-08	mr1699	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107138250	NA	5.98E-08	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107138250	NA	6.45E-08	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107138250	NA	4.62E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107138250	NA	2.55E-10	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107138250	NA	1.13E-06	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107138250	2.24E-09	NA	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107138250	2.93E-08	8.70E-14	mr1699_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107138250	NA	1.65E-08	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251