\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107115494:

Variant ID: vg0107115494 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7115494
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.97, G: 0.03, others allele: 0.00, population size: 120. )

Flanking Sequence (100 bp) in Reference Genome:


ACATTTTCACCACACACGCAAACAATTATTCTGTTCCAGTTGCATCACACACAAAACAAATGCTTTCCCCATCCTTTCAAAACGAATTTTGTTTTACCCC[A/G]
TTCCCAAATTAAAAACCATCGAAACAAAAGGGAAAGAAAAAAAAGGTAACAAAACAACAACCAACGACTAGCCGCAATCCAGCCGTTGGCATTCAAAAAT

Reverse complement sequence

ATTTTTGAATGCCAACGGCTGGATTGCGGCTAGTCGTTGGTTGTTGTTTTGTTACCTTTTTTTTCTTTCCCTTTTGTTTCGATGGTTTTTAATTTGGGAA[T/C]
GGGGTAAAACAAAATTCGTTTTGAAAGGATGGGGAAAGCATTTGTTTTGTGTGTGATGCAACTGGAACAGAATAATTGTTTGCGTGTGTGGTGAAAATGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.30% 35.10% 0.23% 0.34% NA
All Indica  2759 48.70% 50.40% 0.33% 0.58% NA
All Japonica  1512 83.20% 16.70% 0.13% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 10.30% 89.40% 0.17% 0.17% NA
Indica II  465 81.10% 18.30% 0.43% 0.22% NA
Indica III  913 43.00% 55.90% 0.11% 0.99% NA
Indica Intermediate  786 65.30% 33.50% 0.64% 0.64% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 54.00% 45.60% 0.40% 0.00% NA
Japonica Intermediate  241 92.50% 7.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107115494 A -> G LOC_Os01g12850.1 upstream_gene_variant ; 4054.0bp to feature; MODIFIER silent_mutation Average:95.864; most accessible tissue: Zhenshan97 young leaf, score: 98.095 N N N N
vg0107115494 A -> G LOC_Os01g12860.1 upstream_gene_variant ; 277.0bp to feature; MODIFIER silent_mutation Average:95.864; most accessible tissue: Zhenshan97 young leaf, score: 98.095 N N N N
vg0107115494 A -> G LOC_Os01g12850-LOC_Os01g12860 intergenic_region ; MODIFIER silent_mutation Average:95.864; most accessible tissue: Zhenshan97 young leaf, score: 98.095 N N N N
vg0107115494 A -> DEL N N silent_mutation Average:95.864; most accessible tissue: Zhenshan97 young leaf, score: 98.095 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107115494 A G 0.02 0.03 0.03 0.01 0.02 0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107115494 2.70E-06 2.70E-06 mr1498 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107115494 NA 2.87E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107115494 NA 1.80E-07 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107115494 NA 9.12E-08 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107115494 NA 8.10E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107115494 1.29E-07 8.40E-10 mr1925 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107115494 3.99E-14 3.16E-16 mr1498_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107115494 2.37E-10 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107115494 7.68E-08 3.10E-07 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107115494 NA 1.96E-08 mr1709_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107115494 1.98E-09 1.98E-09 mr1925_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251