Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107091002:

Variant ID: vg0107091002 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7091002
Reference Allele: A	Alternative Allele: T
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TATACTTCTTAGAGGAAAATAAAAGGGTATTCGATCCATGCGATTGCAAATAAATGAGGAAGAAGATGGAAAATATGACGACAGAACGATTCTAATTTTT[A/T]
AAAATTTATGTGACATGGATATAAATAGATGAATTGTAATGATACTTATTTGAAATAACATGTGTGTAATGGCATGAATTAAATTAATCCAAAATAAAAC

Reverse complement sequence

GTTTTATTTTGGATTAATTTAATTCATGCCATTACACACATGTTATTTCAAATAAGTATCATTACAATTCATCTATTTATATCCATGTCACATAAATTTT[T/A]
AAAAATTAGAATCGTTCTGTCGTCATATTTTCCATCTTCTTCCTCATTTATTTGCAATCGCATGGATCGAATACCCTTTTATTTTCCTCTAAGAAGTATA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.80%	25.20%	0.00%	0.00%	NA
All Indica	2759	97.90%	2.10%	0.00%	0.00%	NA
All Japonica	1512	27.50%	72.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	98.70%	1.30%	0.00%	0.00%	NA
Indica Intermediate	786	94.70%	5.30%	0.00%	0.00%	NA
Temperate Japonica	767	4.00%	96.00%	0.00%	0.00%	NA
Tropical Japonica	504	67.90%	32.10%	0.00%	0.00%	NA
Japonica Intermediate	241	17.80%	82.20%	0.00%	0.00%	NA
VI/Aromatic	96	79.20%	20.80%	0.00%	0.00%	NA
Intermediate	90	80.00%	20.00%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107091002	A -> T	LOC_Os01g12800.1	upstream_gene_variant ; 1808.0bp to feature; MODIFIER	silent_mutation	Average:46.244; most accessible tissue: Callus, score: 84.644	N	N	N	N
vg0107091002	A -> T	LOC_Os01g12810.1	upstream_gene_variant ; 1030.0bp to feature; MODIFIER	silent_mutation	Average:46.244; most accessible tissue: Callus, score: 84.644	N	N	N	N
vg0107091002	A -> T	LOC_Os01g12810.3	upstream_gene_variant ; 1030.0bp to feature; MODIFIER	silent_mutation	Average:46.244; most accessible tissue: Callus, score: 84.644	N	N	N	N
vg0107091002	A -> T	LOC_Os01g12810.5	upstream_gene_variant ; 1030.0bp to feature; MODIFIER	silent_mutation	Average:46.244; most accessible tissue: Callus, score: 84.644	N	N	N	N
vg0107091002	A -> T	LOC_Os01g12810.2	upstream_gene_variant ; 1031.0bp to feature; MODIFIER	silent_mutation	Average:46.244; most accessible tissue: Callus, score: 84.644	N	N	N	N
vg0107091002	A -> T	LOC_Os01g12810.4	upstream_gene_variant ; 1031.0bp to feature; MODIFIER	silent_mutation	Average:46.244; most accessible tissue: Callus, score: 84.644	N	N	N	N
vg0107091002	A -> T	LOC_Os01g12820.1	downstream_gene_variant ; 4372.0bp to feature; MODIFIER	silent_mutation	Average:46.244; most accessible tissue: Callus, score: 84.644	N	N	N	N
vg0107091002	A -> T	LOC_Os01g12800-LOC_Os01g12810	intergenic_region ; MODIFIER	silent_mutation	Average:46.244; most accessible tissue: Callus, score: 84.644	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107091002	NA	2.53E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	4.10E-07	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	2.59E-08	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	2.57E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	2.66E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	2.77E-08	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	4.13E-42	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	3.68E-09	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	1.16E-09	NA	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	3.53E-07	2.70E-31	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	1.24E-17	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	4.49E-08	mr1806	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	2.71E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	9.51E-36	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	5.95E-14	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	1.43E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	1.25E-07	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	9.76E-45	mr1533_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	2.07E-25	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	2.11E-10	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	1.66E-06	NA	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	9.29E-07	1.51E-24	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	1.17E-15	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	4.46E-11	mr1830_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	6.24E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	1.25E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002	NA	1.31E-11	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251