\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107091002:

Variant ID: vg0107091002 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7091002
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TATACTTCTTAGAGGAAAATAAAAGGGTATTCGATCCATGCGATTGCAAATAAATGAGGAAGAAGATGGAAAATATGACGACAGAACGATTCTAATTTTT[A/T]
AAAATTTATGTGACATGGATATAAATAGATGAATTGTAATGATACTTATTTGAAATAACATGTGTGTAATGGCATGAATTAAATTAATCCAAAATAAAAC

Reverse complement sequence

GTTTTATTTTGGATTAATTTAATTCATGCCATTACACACATGTTATTTCAAATAAGTATCATTACAATTCATCTATTTATATCCATGTCACATAAATTTT[T/A]
AAAAATTAGAATCGTTCTGTCGTCATATTTTCCATCTTCTTCCTCATTTATTTGCAATCGCATGGATCGAATACCCTTTTATTTTCCTCTAAGAAGTATA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.80% 25.20% 0.00% 0.00% NA
All Indica  2759 97.90% 2.10% 0.00% 0.00% NA
All Japonica  1512 27.50% 72.50% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 98.70% 1.30% 0.00% 0.00% NA
Indica Intermediate  786 94.70% 5.30% 0.00% 0.00% NA
Temperate Japonica  767 4.00% 96.00% 0.00% 0.00% NA
Tropical Japonica  504 67.90% 32.10% 0.00% 0.00% NA
Japonica Intermediate  241 17.80% 82.20% 0.00% 0.00% NA
VI/Aromatic  96 79.20% 20.80% 0.00% 0.00% NA
Intermediate  90 80.00% 20.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107091002 A -> T LOC_Os01g12800.1 upstream_gene_variant ; 1808.0bp to feature; MODIFIER silent_mutation Average:46.244; most accessible tissue: Callus, score: 84.644 N N N N
vg0107091002 A -> T LOC_Os01g12810.1 upstream_gene_variant ; 1030.0bp to feature; MODIFIER silent_mutation Average:46.244; most accessible tissue: Callus, score: 84.644 N N N N
vg0107091002 A -> T LOC_Os01g12810.3 upstream_gene_variant ; 1030.0bp to feature; MODIFIER silent_mutation Average:46.244; most accessible tissue: Callus, score: 84.644 N N N N
vg0107091002 A -> T LOC_Os01g12810.5 upstream_gene_variant ; 1030.0bp to feature; MODIFIER silent_mutation Average:46.244; most accessible tissue: Callus, score: 84.644 N N N N
vg0107091002 A -> T LOC_Os01g12810.2 upstream_gene_variant ; 1031.0bp to feature; MODIFIER silent_mutation Average:46.244; most accessible tissue: Callus, score: 84.644 N N N N
vg0107091002 A -> T LOC_Os01g12810.4 upstream_gene_variant ; 1031.0bp to feature; MODIFIER silent_mutation Average:46.244; most accessible tissue: Callus, score: 84.644 N N N N
vg0107091002 A -> T LOC_Os01g12820.1 downstream_gene_variant ; 4372.0bp to feature; MODIFIER silent_mutation Average:46.244; most accessible tissue: Callus, score: 84.644 N N N N
vg0107091002 A -> T LOC_Os01g12800-LOC_Os01g12810 intergenic_region ; MODIFIER silent_mutation Average:46.244; most accessible tissue: Callus, score: 84.644 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107091002 NA 2.53E-08 mr1364 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 4.10E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 2.59E-08 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 2.57E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 2.66E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 2.77E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 4.13E-42 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 3.68E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 1.16E-09 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 3.53E-07 2.70E-31 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 1.24E-17 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 4.49E-08 mr1806 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 2.71E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 9.51E-36 mr1980 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 5.95E-14 mr1982 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 1.43E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 1.25E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 9.76E-45 mr1533_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 2.07E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 2.11E-10 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 1.66E-06 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 9.29E-07 1.51E-24 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 1.17E-15 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 4.46E-11 mr1830_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 6.24E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 1.25E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107091002 NA 1.31E-11 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251