\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107090989:

Variant ID: vg0107090989 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7090989
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, T: 0.04, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGAGGGTGCATTATACTTCTTAGAGGAAAATAAAAGGGTATTCGATCCATGCGATTGCAAATAAATGAGGAAGAAGATGGAAAATATGACGACAGAAC[G/T]
ATTCTAATTTTTAAAAATTTATGTGACATGGATATAAATAGATGAATTGTAATGATACTTATTTGAAATAACATGTGTGTAATGGCATGAATTAAATTAA

Reverse complement sequence

TTAATTTAATTCATGCCATTACACACATGTTATTTCAAATAAGTATCATTACAATTCATCTATTTATATCCATGTCACATAAATTTTTAAAAATTAGAAT[C/A]
GTTCTGTCGTCATATTTTCCATCTTCTTCCTCATTTATTTGCAATCGCATGGATCGAATACCCTTTTATTTTCCTCTAAGAAGTATAATGCACCCTCTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.90% 36.70% 0.47% 0.00% NA
All Indica  2759 50.50% 48.80% 0.76% 0.00% NA
All Japonica  1512 75.90% 24.10% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 14.30% 85.00% 0.67% 0.00% NA
Indica II  465 81.30% 18.50% 0.22% 0.00% NA
Indica III  913 43.30% 55.60% 1.10% 0.00% NA
Indica Intermediate  786 67.90% 31.30% 0.76% 0.00% NA
Temperate Japonica  767 97.50% 2.50% 0.00% 0.00% NA
Tropical Japonica  504 38.50% 61.50% 0.00% 0.00% NA
Japonica Intermediate  241 85.10% 14.50% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107090989 G -> T LOC_Os01g12800.1 upstream_gene_variant ; 1795.0bp to feature; MODIFIER silent_mutation Average:46.038; most accessible tissue: Callus, score: 84.644 N N N N
vg0107090989 G -> T LOC_Os01g12810.1 upstream_gene_variant ; 1043.0bp to feature; MODIFIER silent_mutation Average:46.038; most accessible tissue: Callus, score: 84.644 N N N N
vg0107090989 G -> T LOC_Os01g12810.3 upstream_gene_variant ; 1043.0bp to feature; MODIFIER silent_mutation Average:46.038; most accessible tissue: Callus, score: 84.644 N N N N
vg0107090989 G -> T LOC_Os01g12810.5 upstream_gene_variant ; 1043.0bp to feature; MODIFIER silent_mutation Average:46.038; most accessible tissue: Callus, score: 84.644 N N N N
vg0107090989 G -> T LOC_Os01g12810.2 upstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:46.038; most accessible tissue: Callus, score: 84.644 N N N N
vg0107090989 G -> T LOC_Os01g12810.4 upstream_gene_variant ; 1044.0bp to feature; MODIFIER silent_mutation Average:46.038; most accessible tissue: Callus, score: 84.644 N N N N
vg0107090989 G -> T LOC_Os01g12820.1 downstream_gene_variant ; 4385.0bp to feature; MODIFIER silent_mutation Average:46.038; most accessible tissue: Callus, score: 84.644 N N N N
vg0107090989 G -> T LOC_Os01g12800-LOC_Os01g12810 intergenic_region ; MODIFIER silent_mutation Average:46.038; most accessible tissue: Callus, score: 84.644 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107090989 NA 5.25E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 1.90E-07 NA mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 1.55E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 1.03E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 1.69E-07 NA mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 7.81E-08 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 2.65E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 3.57E-07 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 1.26E-24 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 1.06E-07 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 5.26E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 4.57E-20 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 2.39E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 4.59E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 2.51E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 1.80E-16 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 3.98E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 3.00E-07 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 5.89E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 3.86E-06 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 3.45E-06 NA mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 7.04E-07 5.53E-13 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 1.34E-10 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 2.86E-07 1.57E-06 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 1.36E-19 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 3.03E-16 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 1.10E-06 NA mr1794_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 8.62E-12 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107090989 NA 3.94E-14 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251