\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107089778:

Variant ID: vg0107089778 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7089778
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.96, G: 0.03, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:


TTTTGAATAAGTATAAACTATATATATGATTGGCAGTCGTAAAATAATAATGAACCCCTTTATAGTAAGAGAAAAAAATACTTGACCAAAAATTATGACT[A/G]
TTGCCTTAATTATAAGCTATAAGTGTATACGATCCAATACTCTCATATCCTATCTTACTATAAAGTTATCTCCCACTAACTCCTTAAGCTTAAAATGCAA

Reverse complement sequence

TTGCATTTTAAGCTTAAGGAGTTAGTGGGAGATAACTTTATAGTAAGATAGGATATGAGAGTATTGGATCGTATACACTTATAGCTTATAATTAAGGCAA[T/C]
AGTCATAATTTTTGGTCAAGTATTTTTTTCTCTTACTATAAAGGGGTTCATTATTATTTTACGACTGCCAATCATATATATAGTTTATACTTATTCAAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 36.60% 0.19% 0.36% NA
All Indica  2759 50.40% 48.80% 0.22% 0.62% NA
All Japonica  1512 75.80% 24.00% 0.20% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 14.10% 85.20% 0.34% 0.34% NA
Indica II  465 81.30% 18.50% 0.22% 0.00% NA
Indica III  913 43.30% 55.60% 0.11% 0.99% NA
Indica Intermediate  786 67.80% 31.20% 0.25% 0.76% NA
Temperate Japonica  767 97.50% 2.30% 0.13% 0.00% NA
Tropical Japonica  504 38.30% 61.50% 0.20% 0.00% NA
Japonica Intermediate  241 85.10% 14.50% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 24.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107089778 A -> G LOC_Os01g12800.1 upstream_gene_variant ; 584.0bp to feature; MODIFIER silent_mutation Average:48.49; most accessible tissue: Callus, score: 73.601 N N N N
vg0107089778 A -> G LOC_Os01g12810.1 upstream_gene_variant ; 2254.0bp to feature; MODIFIER silent_mutation Average:48.49; most accessible tissue: Callus, score: 73.601 N N N N
vg0107089778 A -> G LOC_Os01g12810.3 upstream_gene_variant ; 2254.0bp to feature; MODIFIER silent_mutation Average:48.49; most accessible tissue: Callus, score: 73.601 N N N N
vg0107089778 A -> G LOC_Os01g12810.5 upstream_gene_variant ; 2254.0bp to feature; MODIFIER silent_mutation Average:48.49; most accessible tissue: Callus, score: 73.601 N N N N
vg0107089778 A -> G LOC_Os01g12810.2 upstream_gene_variant ; 2255.0bp to feature; MODIFIER silent_mutation Average:48.49; most accessible tissue: Callus, score: 73.601 N N N N
vg0107089778 A -> G LOC_Os01g12810.4 upstream_gene_variant ; 2255.0bp to feature; MODIFIER silent_mutation Average:48.49; most accessible tissue: Callus, score: 73.601 N N N N
vg0107089778 A -> G LOC_Os01g12790.1 downstream_gene_variant ; 4182.0bp to feature; MODIFIER silent_mutation Average:48.49; most accessible tissue: Callus, score: 73.601 N N N N
vg0107089778 A -> G LOC_Os01g12800-LOC_Os01g12810 intergenic_region ; MODIFIER silent_mutation Average:48.49; most accessible tissue: Callus, score: 73.601 N N N N
vg0107089778 A -> DEL N N silent_mutation Average:48.49; most accessible tissue: Callus, score: 73.601 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107089778 NA 1.21E-14 mr1301 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 4.59E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 1.14E-11 mr1410 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 8.50E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 5.50E-07 NA mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 1.31E-06 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 3.99E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 1.46E-07 NA mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 6.68E-08 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 1.15E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 1.68E-07 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 5.98E-06 7.71E-26 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 7.55E-08 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 1.87E-21 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 5.18E-09 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 1.70E-07 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 6.55E-08 mr1993 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 2.36E-17 mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 4.90E-07 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 2.60E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 3.06E-08 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 5.22E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 9.83E-07 mr1583_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 4.65E-06 3.25E-12 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 7.17E-11 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 4.98E-07 1.70E-06 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 6.25E-21 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 2.55E-17 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 3.18E-06 NA mr1794_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 1.16E-12 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107089778 NA 2.48E-15 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251