Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107080292:

Variant ID: vg0107080292 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 7080292
Reference Allele: T	Alternative Allele: C,TGCC
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGTGTTTCTGCCCTTGCTTTACGATTCAATTGTGATTTTATCATGTATTTTAGGGTTTGTGATTTTTACACCTATTTTTTTAAATGAAACAGCCTTCTGC[T/C,TGCC]
ACTAGGTTTGACAGAAGTCTGGTGGGCCGGAATTTTCGAATTAAACAAAAAAAGAAAATGTTATTATAATTTGTGAATGACTATGCTACCCTTGGTTCAA

Reverse complement sequence

TTGAACCAAGGGTAGCATAGTCATTCACAAATTATAATAACATTTTCTTTTTTTGTTTAATTCGAAAATTCCGGCCCACCAGACTTCTGTCAAACCTAGT[A/G,GGCA]
GCAGAAGGCTGTTTCATTTAAAAAAATAGGTGTAAAAATCACAAACCCTAAAATACATGATAAAATCACAATTGAATCGTAAAGCAAGGGCAGAAACACA

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	79.10%	10.60%	0.06%	0.00%	TGCC: 10.30%
All Indica	2759	78.50%	5.20%	0.07%	0.00%	TGCC: 16.27%
All Japonica	1512	98.10%	0.90%	0.07%	0.00%	TGCC: 0.99%
Aus	269	2.60%	97.40%	0.00%	0.00%	NA
Indica I	595	99.00%	0.00%	0.00%	0.00%	TGCC: 1.01%
Indica II	465	51.00%	0.90%	0.43%	0.00%	TGCC: 47.74%
Indica III	913	86.60%	8.90%	0.00%	0.00%	TGCC: 4.49%
Indica Intermediate	786	69.70%	7.40%	0.00%	0.00%	TGCC: 22.90%
Temperate Japonica	767	98.20%	0.40%	0.13%	0.00%	TGCC: 1.30%
Tropical Japonica	504	97.80%	1.40%	0.00%	0.00%	TGCC: 0.79%
Japonica Intermediate	241	98.30%	1.20%	0.00%	0.00%	TGCC: 0.41%
VI/Aromatic	96	25.00%	69.80%	0.00%	0.00%	TGCC: 5.21%
Intermediate	90	63.30%	16.70%	0.00%	0.00%	TGCC: 20.00%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107080292	T -> TGCC	LOC_Os01g12780.1	upstream_gene_variant ; 3516.0bp to feature; MODIFIER	silent_mutation	Average:66.256; most accessible tissue: Callus, score: 91.354	N	N	N	N
vg0107080292	T -> TGCC	LOC_Os01g12790.1	intron_variant ; MODIFIER	silent_mutation	Average:66.256; most accessible tissue: Callus, score: 91.354	N	N	N	N
vg0107080292	T -> C	LOC_Os01g12780.1	upstream_gene_variant ; 3515.0bp to feature; MODIFIER	silent_mutation	Average:66.256; most accessible tissue: Callus, score: 91.354	N	N	N	N
vg0107080292	T -> C	LOC_Os01g12790.1	intron_variant ; MODIFIER	silent_mutation	Average:66.256; most accessible tissue: Callus, score: 91.354	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107080292	NA	1.82E-07	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	1.30E-09	mr1399	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	2.41E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	4.23E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	2.96E-08	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	2.97E-09	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	3.25E-08	1.44E-31	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	4.86E-18	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	1.29E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	9.53E-08	mr1993	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	8.07E-06	mr1398_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	6.04E-08	mr1399_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	2.36E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	3.32E-09	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	4.26E-08	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	2.72E-11	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	5.53E-08	1.54E-26	mr1699_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	9.23E-12	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	5.96E-16	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	5.66E-09	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292	NA	1.29E-12	mr1993_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251