\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107080292:

Variant ID: vg0107080292 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 7080292
Reference Allele: TAlternative Allele: C,TGCC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGTGTTTCTGCCCTTGCTTTACGATTCAATTGTGATTTTATCATGTATTTTAGGGTTTGTGATTTTTACACCTATTTTTTTAAATGAAACAGCCTTCTGC[T/C,TGCC]
ACTAGGTTTGACAGAAGTCTGGTGGGCCGGAATTTTCGAATTAAACAAAAAAAGAAAATGTTATTATAATTTGTGAATGACTATGCTACCCTTGGTTCAA

Reverse complement sequence

TTGAACCAAGGGTAGCATAGTCATTCACAAATTATAATAACATTTTCTTTTTTTGTTTAATTCGAAAATTCCGGCCCACCAGACTTCTGTCAAACCTAGT[A/G,GGCA]
GCAGAAGGCTGTTTCATTTAAAAAAATAGGTGTAAAAATCACAAACCCTAAAATACATGATAAAATCACAATTGAATCGTAAAGCAAGGGCAGAAACACA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 79.10% 10.60% 0.06% 0.00% TGCC: 10.30%
All Indica  2759 78.50% 5.20% 0.07% 0.00% TGCC: 16.27%
All Japonica  1512 98.10% 0.90% 0.07% 0.00% TGCC: 0.99%
Aus  269 2.60% 97.40% 0.00% 0.00% NA
Indica I  595 99.00% 0.00% 0.00% 0.00% TGCC: 1.01%
Indica II  465 51.00% 0.90% 0.43% 0.00% TGCC: 47.74%
Indica III  913 86.60% 8.90% 0.00% 0.00% TGCC: 4.49%
Indica Intermediate  786 69.70% 7.40% 0.00% 0.00% TGCC: 22.90%
Temperate Japonica  767 98.20% 0.40% 0.13% 0.00% TGCC: 1.30%
Tropical Japonica  504 97.80% 1.40% 0.00% 0.00% TGCC: 0.79%
Japonica Intermediate  241 98.30% 1.20% 0.00% 0.00% TGCC: 0.41%
VI/Aromatic  96 25.00% 69.80% 0.00% 0.00% TGCC: 5.21%
Intermediate  90 63.30% 16.70% 0.00% 0.00% TGCC: 20.00%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107080292 T -> TGCC LOC_Os01g12780.1 upstream_gene_variant ; 3516.0bp to feature; MODIFIER silent_mutation Average:66.256; most accessible tissue: Callus, score: 91.354 N N N N
vg0107080292 T -> TGCC LOC_Os01g12790.1 intron_variant ; MODIFIER silent_mutation Average:66.256; most accessible tissue: Callus, score: 91.354 N N N N
vg0107080292 T -> C LOC_Os01g12780.1 upstream_gene_variant ; 3515.0bp to feature; MODIFIER silent_mutation Average:66.256; most accessible tissue: Callus, score: 91.354 N N N N
vg0107080292 T -> C LOC_Os01g12790.1 intron_variant ; MODIFIER silent_mutation Average:66.256; most accessible tissue: Callus, score: 91.354 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107080292 NA 1.82E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 1.30E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 2.41E-07 mr1422 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 4.23E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 2.96E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 2.97E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 3.25E-08 1.44E-31 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 4.86E-18 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 1.29E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 9.53E-08 mr1993 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 8.07E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 6.04E-08 mr1399_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 2.36E-06 mr1422_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 3.32E-09 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 4.26E-08 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 2.72E-11 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 5.53E-08 1.54E-26 mr1699_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 9.23E-12 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 5.96E-16 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 5.66E-09 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107080292 NA 1.29E-12 mr1993_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251