Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107079944:

Variant ID: vg0107079944 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7079944
Reference Allele: G	Alternative Allele: C
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGCTATACTATTAAACCTGCTCTTATAAAGGTCAGACATCATGCTAGATGTGTCGATGGCGATGGAGTATCTTCACCATGAGCATTATGAGATTGTCCA[G/C]
CACTGTGACCAGAAGCCTAGTAATGTGCTATTTGACGAGGAAACGACGGTGCATGTGGCGGACTTTGGCATCGCAAAGCTGCTGCTGGGTGATGACACCT

Reverse complement sequence

AGGTGTCATCACCCAGCAGCAGCTTTGCGATGCCAAAGTCCGCCACATGCACCGTCGTTTCCTCGTCAAATAGCACATTACTAGGCTTCTGGTCACAGTG[C/G]
TGGACAATCTCATAATGCTCATGGTGAAGATACTCCATCGCCATCGACACATCTAGCATGATGTCTGACCTTTATAAGAGCAGGTTTAATAGTATAGCCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	75.80%	24.20%	0.04%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.04%	0.00%	NA
All Japonica	1512	28.00%	72.00%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	99.10%	0.80%	0.13%	0.00%	NA
Temperate Japonica	767	4.60%	95.40%	0.00%	0.00%	NA
Tropical Japonica	504	68.50%	31.50%	0.00%	0.00%	NA
Japonica Intermediate	241	17.80%	82.20%	0.00%	0.00%	NA
VI/Aromatic	96	79.20%	20.80%	0.00%	0.00%	NA
Intermediate	90	76.70%	22.20%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107079944	G -> C	LOC_Os01g12790.1	missense_variant ; p.Gln15His; MODERATE	nonsynonymous_codon ; Q15H	Average:70.908; most accessible tissue: Callus, score: 93.427	benign	-1.161	DELETERIOUS	0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107079944	NA	2.25E-09	mr1005	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	3.65E-15	mr1228	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	1.89E-17	mr1308	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	2.02E-08	mr1364	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	4.38E-07	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	6.04E-07	4.14E-19	mr1422	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	2.63E-06	5.41E-10	mr1422	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	1.99E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	2.73E-07	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	9.46E-08	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	9.33E-40	mr1533	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	1.94E-08	mr1533	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	8.89E-07	NA	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	1.32E-08	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	3.57E-08	mr1691	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	2.30E-08	NA	mr1699	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	5.78E-06	8.91E-29	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	2.96E-14	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	9.23E-33	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	1.89E-06	mr1422_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	4.75E-07	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	1.15E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	2.52E-21	mr1679_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	3.59E-06	NA	mr1699_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	2.84E-06	3.36E-23	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	8.78E-27	mr1768_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	2.00E-13	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079944	NA	3.17E-14	mr1790_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251