\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107079035:

Variant ID: vg0107079035 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7079035
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAAGCATTTCTCCACCAGTGGAATCTCCCTTGGGATGAAAAAGCTACCCCTGTCATATAGAAGGGTTTTTTTTCCCGGCGAGCCGTGCCATGATTCCTC[G/A]
CAATTCTTTTTAATAGATTAAATCGGTCTCTACATCTAAACGGAAAATAGATACTAAACACCGGAACCTGATAAAGGTACTAAACACTTGTTCCAACATA

Reverse complement sequence

TATGTTGGAACAAGTGTTTAGTACCTTTATCAGGTTCCGGTGTTTAGTATCTATTTTCCGTTTAGATGTAGAGACCGATTTAATCTATTAAAAAGAATTG[C/T]
GAGGAATCATGGCACGGCTCGCCGGGAAAAAAAACCCTTCTATATGACAGGGGTAGCTTTTTCATCCCAAGGGAGATTCCACTGGTGGAGAAATGCTTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.90% 2.90% 0.25% 0.00% NA
All Indica  2759 99.90% 0.10% 0.00% 0.00% NA
All Japonica  1512 91.10% 8.10% 0.73% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 99.50% 0.30% 0.26% 0.00% NA
Tropical Japonica  504 84.70% 14.70% 0.60% 0.00% NA
Japonica Intermediate  241 78.00% 19.50% 2.49% 0.00% NA
VI/Aromatic  96 88.50% 10.40% 1.04% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107079035 G -> A LOC_Os01g12780.1 upstream_gene_variant ; 2258.0bp to feature; MODIFIER silent_mutation Average:39.082; most accessible tissue: Callus, score: 85.345 N N N N
vg0107079035 G -> A LOC_Os01g12790.1 upstream_gene_variant ; 865.0bp to feature; MODIFIER silent_mutation Average:39.082; most accessible tissue: Callus, score: 85.345 N N N N
vg0107079035 G -> A LOC_Os01g12780-LOC_Os01g12790 intergenic_region ; MODIFIER silent_mutation Average:39.082; most accessible tissue: Callus, score: 85.345 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107079035 6.64E-07 6.64E-07 mr1159_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 1.93E-06 1.93E-06 mr1192_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 3.37E-06 3.37E-06 mr1245_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 1.68E-06 1.68E-06 mr1278_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 8.95E-06 8.95E-06 mr1284_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 4.69E-07 4.69E-07 mr1286_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 5.93E-09 5.93E-09 mr1312_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 2.26E-07 2.26E-07 mr1373_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 4.54E-06 4.54E-06 mr1374_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 2.11E-06 3.21E-07 mr1397_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 2.81E-06 2.81E-06 mr1652_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 9.04E-08 9.04E-08 mr1663_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 4.48E-06 2.23E-07 mr1665_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 1.88E-06 1.88E-06 mr1674_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 8.25E-06 8.25E-06 mr1687_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 1.94E-07 1.94E-07 mr1688_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 1.87E-06 1.87E-06 mr1697_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 NA 1.04E-06 mr1738_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 NA 2.85E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 2.97E-07 2.97E-07 mr1822_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 4.33E-06 4.33E-06 mr1832_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 NA 8.31E-06 mr1833_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 3.26E-06 3.26E-06 mr1843_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107079035 1.48E-06 1.48E-06 mr1847_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251