\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107059016:

Variant ID: vg0107059016 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7059016
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.07, others allele: 0.00, population size: 108. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCATATGCCTTTTACCAATGGGTTATCTGTACGGGTTTGATGTTTCCATTCAGCTCCCTCCGTTTTACAATGTAAGACTTTCTAACATTACCCACATA[C/T]
ATATAGATATTAATAAATCTGAATACATATATATGTCTAGATTCATTAACATGTAAATAAATGTGGACAATGCTAGAAAGTCTTACATTGTGAAACGGAG

Reverse complement sequence

CTCCGTTTCACAATGTAAGACTTTCTAGCATTGTCCACATTTATTTACATGTTAATGAATCTAGACATATATATGTATTCAGATTTATTAATATCTATAT[G/A]
TATGTGGGTAATGTTAGAAAGTCTTACATTGTAAAACGGAGGGAGCTGAATGGAAACATCAAACCCGTACAGATAACCCATTGGTAAAAGGCATATGCAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.70% 34.70% 0.23% 0.36% NA
All Indica  2759 56.70% 42.40% 0.40% 0.58% NA
All Japonica  1512 72.40% 27.60% 0.00% 0.07% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 86.60% 12.80% 0.34% 0.34% NA
Indica II  465 41.90% 57.80% 0.22% 0.00% NA
Indica III  913 55.00% 44.00% 0.22% 0.77% NA
Indica Intermediate  786 44.70% 53.70% 0.76% 0.89% NA
Temperate Japonica  767 66.80% 33.20% 0.00% 0.00% NA
Tropical Japonica  504 79.80% 20.00% 0.00% 0.20% NA
Japonica Intermediate  241 74.70% 25.30% 0.00% 0.00% NA
VI/Aromatic  96 88.50% 11.50% 0.00% 0.00% NA
Intermediate  90 60.00% 40.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107059016 C -> T LOC_Os01g12760.1 upstream_gene_variant ; 2328.0bp to feature; MODIFIER silent_mutation Average:52.337; most accessible tissue: Callus, score: 72.52 N N N N
vg0107059016 C -> T LOC_Os01g12750.1 downstream_gene_variant ; 2641.0bp to feature; MODIFIER silent_mutation Average:52.337; most accessible tissue: Callus, score: 72.52 N N N N
vg0107059016 C -> T LOC_Os01g12750-LOC_Os01g12760 intergenic_region ; MODIFIER silent_mutation Average:52.337; most accessible tissue: Callus, score: 72.52 N N N N
vg0107059016 C -> DEL N N silent_mutation Average:52.337; most accessible tissue: Callus, score: 72.52 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107059016 NA 1.90E-07 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 2.66E-09 NA mr1498 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 6.09E-07 NA mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 NA 1.65E-06 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 NA 4.21E-07 mr1936 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 NA 4.19E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 1.66E-07 2.47E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 7.25E-09 3.26E-09 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 3.80E-06 NA mr1699_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 1.43E-06 NA mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 7.72E-08 5.00E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 1.67E-07 8.46E-09 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 NA 3.82E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107059016 1.12E-06 1.11E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251