\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107031520:

Variant ID: vg0107031520 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7031520
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.92, T: 0.07, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:


ATATATGCCCTTTAATTTTCCATCAGCTTAAGCACTGGGGTTAAAATAAAATATGCATGCAAACTTTGCCTTACTAACACGCATTTACTTGCAATTGCTT[A/T]
GCTGATTGAAATCTCACTAAATCTGCTGCTACTTTGATTGGATTAACCAACTACAGACAAGTTGACTGCCCTGGCCGGGCAGTGAACATGGCTGGTACAG

Reverse complement sequence

CTGTACCAGCCATGTTCACTGCCCGGCCAGGGCAGTCAACTTGTCTGTAGTTGGTTAATCCAATCAAAGTAGCAGCAGATTTAGTGAGATTTCAATCAGC[T/A]
AAGCAATTGCAAGTAAATGCGTGTTAGTAAGGCAAAGTTTGCATGCATATTTTATTTTAACCCCAGTGCTTAAGCTGATGGAAAATTAAAGGGCATATAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 61.90% 33.70% 2.37% 2.05% NA
All Indica  2759 47.20% 45.50% 3.91% 3.37% NA
All Japonica  1512 79.00% 20.90% 0.00% 0.13% NA
Aus  269 99.60% 0.00% 0.00% 0.37% NA
Indica I  595 13.40% 84.50% 1.51% 0.50% NA
Indica II  465 73.80% 16.60% 5.38% 4.30% NA
Indica III  913 44.00% 48.50% 3.18% 4.27% NA
Indica Intermediate  786 60.80% 29.50% 5.73% 3.94% NA
Temperate Japonica  767 98.30% 1.40% 0.00% 0.26% NA
Tropical Japonica  504 44.20% 55.80% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 72.20% 22.20% 4.44% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107031520 A -> T LOC_Os01g12710.1 downstream_gene_variant ; 910.0bp to feature; MODIFIER silent_mutation Average:94.17; most accessible tissue: Callus, score: 97.118 N N N N
vg0107031520 A -> T LOC_Os01g12710.2 downstream_gene_variant ; 910.0bp to feature; MODIFIER silent_mutation Average:94.17; most accessible tissue: Callus, score: 97.118 N N N N
vg0107031520 A -> T LOC_Os01g12710-LOC_Os01g12720 intergenic_region ; MODIFIER silent_mutation Average:94.17; most accessible tissue: Callus, score: 97.118 N N N N
vg0107031520 A -> DEL N N silent_mutation Average:94.17; most accessible tissue: Callus, score: 97.118 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107031520 A T -0.08 -0.03 -0.03 0.01 0.0 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107031520 NA 5.21E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 2.29E-10 NA mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 3.08E-06 6.71E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 NA 1.47E-10 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 1.71E-11 NA mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 3.52E-06 4.99E-09 mr1676 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 3.27E-07 1.33E-12 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 8.87E-06 NA mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 3.19E-06 1.43E-19 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 NA 9.26E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 NA 1.12E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 NA 5.74E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 6.71E-07 5.29E-23 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 NA 7.80E-06 mr1821 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 NA 1.12E-12 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 NA 8.10E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 2.03E-08 3.41E-11 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 NA 6.48E-08 mr1551_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 NA 5.93E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 2.39E-07 NA mr1676_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 8.46E-08 2.16E-14 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 2.64E-09 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 9.07E-07 2.93E-07 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 1.78E-08 9.23E-25 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107031520 NA 4.77E-12 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251