\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107015964:

Variant ID: vg0107015964 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 7015964
Reference Allele: AAlternative Allele: AAGCACGTTATTAGTTGTCGATGGTAGCT,T,AAGCACGTTATTGGTTGTCGATGGTAGCT
Primary Allele: AAGCACGTTATTAGTTGTCG ATGGTAGCTSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGTAATTAAATTTAGAGCGGTTCAGTGGGAGCTTTCATAGTCCTAGTGTCGATAGTGAGGGCTCAAGCTCCCACGGCACCAATAGCAGATCCGCCGTTGC[A/AAGCACGTTATTAGTTGTCGATGGTAGCT,T,AAGCACGTTATTGGTTGTCGATGGTAGCT]
AGCGCTTCCCTCAATATGTTACACACTAGTACAAATGTTCTTTATTTTCCAACACCTATAAGCTTTTAGTGGTGTGCTGGATACTTTCTTTGTGGAAGAT

Reverse complement sequence

ATCTTCCACAAAGAAAGTATCCAGCACACCACTAAAAGCTTATAGGTGTTGGAAAATAAAGAACATTTGTACTAGTGTGTAACATATTGAGGGAAGCGCT[T/AGCTACCATCGACAACTAATAACGTGCTT,A,AGCTACCATCGACAACCAATAACGTGCTT]
GCAACGGCGGATCTGCTATTGGTGCCGTGGGAGCTTGAGCCCTCACTATCGACACTAGGACTATGAAAGCTCCCACTGAACCGCTCTAAATTTAATTACT

Allele Frequencies:

Populations Population SizeFrequency of AAGCACGTTATTAGTTGTCG ATGGTAGCT(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 26.20% 0.53% 0.00% T: 0.17%; AAGCACGTTATTGGTTGTCGATGGTAGCT: 0.06%
All Indica  2759 97.70% 1.20% 0.72% 0.00% T: 0.25%; AAGCACGTTATTGGTTGTCGATGGTAGCT: 0.11%
All Japonica  1512 24.40% 75.50% 0.13% 0.00% NA
Aus  269 98.50% 0.70% 0.37% 0.00% T: 0.37%
Indica I  595 97.60% 1.30% 1.01% 0.00% NA
Indica II  465 97.80% 0.90% 1.29% 0.00% NA
Indica III  913 98.40% 1.00% 0.11% 0.00% T: 0.44%; AAGCACGTTATTGGTTGTCGATGGTAGCT: 0.11%
Indica Intermediate  786 96.80% 1.70% 0.89% 0.00% T: 0.38%; AAGCACGTTATTGGTTGTCGATGGTAGCT: 0.25%
Temperate Japonica  767 3.30% 96.60% 0.13% 0.00% NA
Tropical Japonica  504 62.10% 37.70% 0.20% 0.00% NA
Japonica Intermediate  241 12.90% 87.10% 0.00% 0.00% NA
VI/Aromatic  96 62.50% 37.50% 0.00% 0.00% NA
Intermediate  90 67.80% 30.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107015964 A -> AAGCACGTTATTAGTTGTCGATGGTAGCT LOC_Os01g12700.1 intron_variant ; MODIFIER silent_mutation Average:50.27; most accessible tissue: Minghui63 root, score: 84.069 N N N N
vg0107015964 A -> T LOC_Os01g12700.1 intron_variant ; MODIFIER silent_mutation Average:50.27; most accessible tissue: Minghui63 root, score: 84.069 N N N N
vg0107015964 A -> AAGCACGTTATTGGTTGTCGATGGTAGCT LOC_Os01g12700.1 intron_variant ; MODIFIER silent_mutation Average:50.27; most accessible tissue: Minghui63 root, score: 84.069 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0107015964 A AAGCA* -0.01 -0.02 -0.06 -0.17 0.03 0.04
vg0107015964 A T 0.0 0.01 0.0 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107015964 NA 1.04E-06 mr1257_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015964 NA 1.00E-06 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015964 3.23E-08 4.04E-13 mr1538_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251