\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107015621:

Variant ID: vg0107015621 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7015621
Reference Allele: GAlternative Allele: A,T
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTGGCCTGCGGTGACCGCGGAGCTTGTAGCCATGTGTACATTTGCACGCAGGTGCGGATTCATAAATAAATAGCATGAAAGGTATTCCCTCCGTTCCA[G/A,T]
GTTAATATGTTTTAACTTTGATCAAAGTCAAACTACTTTAATTTTAACTAAGTTTATAGATAAATATAGTAATATTTATAATACCAAATTAGTTTCATTA

Reverse complement sequence

TAATGAAACTAATTTGGTATTATAAATATTACTATATTTATCTATAAACTTAGTTAAAATTAAAGTAGTTTGACTTTGATCAAAGTTAAAACATATTAAC[C/T,A]
TGGAACGGAGGGAATACCTTTCATGCTATTTATTTATGAATCCGCACCTGCGTGCAAATGTACACATGGCTACAAGCTCCGCGGTCACCGCAGGCCACCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 64.60% 34.20% 0.68% 0.47% T: 0.04%
All Indica  2759 51.80% 46.40% 0.98% 0.80% NA
All Japonica  1512 79.20% 20.80% 0.07% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 15.30% 84.70% 0.00% 0.00% NA
Indica II  465 81.70% 17.00% 0.65% 0.65% NA
Indica III  913 47.90% 49.90% 0.88% 1.31% NA
Indica Intermediate  786 66.40% 30.70% 2.04% 0.89% NA
Temperate Japonica  767 98.60% 1.40% 0.00% 0.00% NA
Tropical Japonica  504 44.40% 55.40% 0.20% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 94.80% 4.20% 1.04% 0.00% NA
Intermediate  90 73.30% 21.10% 3.33% 0.00% T: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107015621 G -> T LOC_Os01g12700.1 intron_variant ; MODIFIER silent_mutation Average:36.973; most accessible tissue: Callus, score: 88.504 N N N N
vg0107015621 G -> A LOC_Os01g12700.1 intron_variant ; MODIFIER silent_mutation Average:36.973; most accessible tissue: Callus, score: 88.504 N N N N
vg0107015621 G -> DEL N N silent_mutation Average:36.973; most accessible tissue: Callus, score: 88.504 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107015621 NA 5.89E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 1.04E-10 NA mr1518 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 1.68E-06 7.88E-08 mr1518 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 4.59E-06 2.82E-11 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 2.51E-12 NA mr1676 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 5.27E-07 2.61E-09 mr1676 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 1.08E-07 2.31E-13 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 NA 1.04E-20 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 NA 6.29E-09 mr1709 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 NA 5.28E-07 mr1739 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 1.48E-07 1.41E-24 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 NA 2.06E-12 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 NA 4.16E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 1.77E-09 4.42E-12 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 NA 3.58E-06 mr1558_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 1.43E-06 NA mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 2.36E-07 2.52E-14 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 1.93E-08 NA mr1699_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 7.55E-06 2.57E-06 mr1699_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 NA 2.66E-17 mr1699_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 6.77E-10 6.41E-27 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015621 NA 1.00E-12 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251