Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107015284:

Variant ID: vg0107015284 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 7015284
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, C: 0.03, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CGGATCAGATCGACGCCGCCGCCGACGTACGTACGCGCGTTTCACAGTCTAGCCGGGACCGATCCCGACGCGACGTAGCTGCAGATCGGAGATGTAGGTA[T/C]
ACGTACGTAGTACTGTATATATAGTAGCTGAGACGTGTACGTACACCGAGTAGCTAGATTGGCTGAAAGCTAGGGCGGCTTTGAGCTCTGCCGCTAGCTT

Reverse complement sequence

AAGCTAGCGGCAGAGCTCAAAGCCGCCCTAGCTTTCAGCCAATCTAGCTACTCGGTGTACGTACACGTCTCAGCTACTATATATACAGTACTACGTACGT[A/G]
TACCTACATCTCCGATCTGCAGCTACGTCGCGTCGGGATCGGTCCCGGCTAGACTGTGAAACGCGCGTACGTACGTCGGCGGCGGCGTCGATCTGATCCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.30%	28.40%	0.28%	0.00%	NA
All Indica	2759	54.20%	45.40%	0.43%	0.00%	NA
All Japonica	1512	97.20%	2.70%	0.07%	0.00%	NA
Aus	269	95.20%	4.80%	0.00%	0.00%	NA
Indica I	595	86.60%	13.40%	0.00%	0.00%	NA
Indica II	465	40.20%	59.10%	0.65%	0.00%	NA
Indica III	913	52.70%	46.90%	0.44%	0.00%	NA
Indica Intermediate	786	39.60%	59.80%	0.64%	0.00%	NA
Temperate Japonica	767	98.40%	1.60%	0.00%	0.00%	NA
Tropical Japonica	504	94.80%	5.00%	0.20%	0.00%	NA
Japonica Intermediate	241	98.30%	1.70%	0.00%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	64.40%	35.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0107015284	T -> C	LOC_Os01g12690.1	downstream_gene_variant ; 4779.0bp to feature; MODIFIER	silent_mutation	Average:41.209; most accessible tissue: Callus, score: 98.9	N	N	N	N
vg0107015284	T -> C	LOC_Os01g12700.1	intron_variant ; MODIFIER	silent_mutation	Average:41.209; most accessible tissue: Callus, score: 98.9	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0107015284	6.38E-07	NA	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	4.44E-08	NA	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	NA	1.85E-08	mr1709	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	NA	1.33E-06	mr1709	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	NA	4.78E-06	mr1821	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	4.58E-10	NA	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	2.40E-11	3.30E-09	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	8.57E-06	NA	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	4.99E-08	NA	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	NA	3.09E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	2.84E-08	NA	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	7.77E-10	7.92E-09	mr1925_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	1.51E-06	2.23E-06	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107015284	2.08E-08	1.91E-08	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251