\
| Variant ID: vg0107014942 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 7014942 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, G: 0.03, others allele: 0.00, population size: 117. )
ACACACACTTTTGTATATTATGCAAGGAGGATACATAAAAATTTTCATATTATTTTTTGAAACTTCTAGTAAGCCAATCAATTATAACCTCTTATAAGCC[T/G]
TGAAAAGCATTTTTAGGCATTTTTTAAAAAGTATCCATCCCTAATAAAATATTGTAGAAAAAAATAACAAAGTCAGTGACATATAATTAACAAAGGGAAA
TTTCCCTTTGTTAATTATATGTCACTGACTTTGTTATTTTTTTCTACAATATTTTATTAGGGATGGATACTTTTTAAAAAATGCCTAAAAATGCTTTTCA[A/C]
GGCTTATAAGAGGTTATAATTGATTGGCTTACTAGAAGTTTCAAAAAATAATATGAAAATTTTTATGTATCCTCCTTGCATAATATACAAAAGTGTGTGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 74.40% | 25.10% | 0.47% | 0.00% | NA |
| All Indica | 2759 | 58.40% | 40.80% | 0.80% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 95.20% | 4.80% | 0.00% | 0.00% | NA |
| Indica I | 595 | 90.80% | 8.90% | 0.34% | 0.00% | NA |
| Indica II | 465 | 42.20% | 57.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 55.10% | 43.70% | 1.20% | 0.00% | NA |
| Indica Intermediate | 786 | 47.30% | 51.70% | 1.02% | 0.00% | NA |
| Temperate Japonica | 767 | 98.40% | 1.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 65.60% | 34.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0107014942 | T -> G | LOC_Os01g12700.1 | upstream_gene_variant ; 189.0bp to feature; MODIFIER | silent_mutation | Average:33.225; most accessible tissue: Callus, score: 91.41 | N | N | N | N |
| vg0107014942 | T -> G | LOC_Os01g12690.1 | downstream_gene_variant ; 4437.0bp to feature; MODIFIER | silent_mutation | Average:33.225; most accessible tissue: Callus, score: 91.41 | N | N | N | N |
| vg0107014942 | T -> G | LOC_Os01g12690-LOC_Os01g12700 | intergenic_region ; MODIFIER | silent_mutation | Average:33.225; most accessible tissue: Callus, score: 91.41 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0107014942 | 9.34E-07 | NA | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | NA | 3.16E-07 | mr1709 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | NA | 6.81E-06 | mr1821 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | 1.81E-09 | NA | mr1498_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | 1.90E-09 | 3.86E-09 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | NA | 2.45E-06 | mr1705_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | 1.81E-06 | NA | mr1769_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | 2.66E-08 | NA | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | 2.25E-08 | NA | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | 1.15E-08 | 2.11E-09 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | 5.95E-07 | 1.14E-06 | mr1951_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0107014942 | 9.11E-08 | 2.03E-08 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |