\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0107014942:

Variant ID: vg0107014942 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 7014942
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.98, G: 0.03, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ACACACACTTTTGTATATTATGCAAGGAGGATACATAAAAATTTTCATATTATTTTTTGAAACTTCTAGTAAGCCAATCAATTATAACCTCTTATAAGCC[T/G]
TGAAAAGCATTTTTAGGCATTTTTTAAAAAGTATCCATCCCTAATAAAATATTGTAGAAAAAAATAACAAAGTCAGTGACATATAATTAACAAAGGGAAA

Reverse complement sequence

TTTCCCTTTGTTAATTATATGTCACTGACTTTGTTATTTTTTTCTACAATATTTTATTAGGGATGGATACTTTTTAAAAAATGCCTAAAAATGCTTTTCA[A/C]
GGCTTATAAGAGGTTATAATTGATTGGCTTACTAGAAGTTTCAAAAAATAATATGAAAATTTTTATGTATCCTCCTTGCATAATATACAAAAGTGTGTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 74.40% 25.10% 0.47% 0.00% NA
All Indica  2759 58.40% 40.80% 0.80% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 95.20% 4.80% 0.00% 0.00% NA
Indica I  595 90.80% 8.90% 0.34% 0.00% NA
Indica II  465 42.20% 57.60% 0.22% 0.00% NA
Indica III  913 55.10% 43.70% 1.20% 0.00% NA
Indica Intermediate  786 47.30% 51.70% 1.02% 0.00% NA
Temperate Japonica  767 98.40% 1.60% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.60% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 65.60% 34.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0107014942 T -> G LOC_Os01g12700.1 upstream_gene_variant ; 189.0bp to feature; MODIFIER silent_mutation Average:33.225; most accessible tissue: Callus, score: 91.41 N N N N
vg0107014942 T -> G LOC_Os01g12690.1 downstream_gene_variant ; 4437.0bp to feature; MODIFIER silent_mutation Average:33.225; most accessible tissue: Callus, score: 91.41 N N N N
vg0107014942 T -> G LOC_Os01g12690-LOC_Os01g12700 intergenic_region ; MODIFIER silent_mutation Average:33.225; most accessible tissue: Callus, score: 91.41 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0107014942 9.34E-07 NA mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 NA 3.16E-07 mr1709 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 NA 6.81E-06 mr1821 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 1.81E-09 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 1.90E-09 3.86E-09 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 NA 2.45E-06 mr1705_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 1.81E-06 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 2.66E-08 NA mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 2.25E-08 NA mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 1.15E-08 2.11E-09 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 5.95E-07 1.14E-06 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0107014942 9.11E-08 2.03E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251