\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106977787:

Variant ID: vg0106977787 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6977787
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTAGGATAATGTTTAAGTCAAACCTTGGTAATATAAATCATGAATAACTCTCAAGTTATTGAGTTTGAAAATATAAAAATTATATATATATAGATTTGT[C/T]
TTGAAAAATACTTTCATAAAAGTATACATATATCACTTTTCAATAAATATTTTTTTATAGAAATAAGAAGTCAAAGTTGTGTTTTGGAGACTGTGTCGCT

Reverse complement sequence

AGCGACACAGTCTCCAAAACACAACTTTGACTTCTTATTTCTATAAAAAAATATTTATTGAAAAGTGATATATGTATACTTTTATGAAAGTATTTTTCAA[G/A]
ACAAATCTATATATATATAATTTTTATATTTTCAAACTCAATAACTTGAGAGTTATTCATGATTTATATTACCAAGGTTTGACTTAAACATTATCCTAGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 6.30% 0.38% 0.02% NA
All Indica  2759 99.90% 0.00% 0.00% 0.04% NA
All Japonica  1512 79.80% 19.20% 1.06% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.00% 0.17% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 45.80% 51.60% 2.58% 0.00% NA
Japonica Intermediate  241 90.50% 8.30% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 91.10% 6.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106977787 C -> T LOC_Os01g12660.1 upstream_gene_variant ; 1077.0bp to feature; MODIFIER silent_mutation Average:37.562; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0106977787 C -> T LOC_Os01g12670.1 upstream_gene_variant ; 1826.0bp to feature; MODIFIER silent_mutation Average:37.562; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0106977787 C -> T LOC_Os01g12670.4 upstream_gene_variant ; 1826.0bp to feature; MODIFIER silent_mutation Average:37.562; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0106977787 C -> T LOC_Os01g12670.5 upstream_gene_variant ; 1826.0bp to feature; MODIFIER silent_mutation Average:37.562; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0106977787 C -> T LOC_Os01g12670.2 upstream_gene_variant ; 1826.0bp to feature; MODIFIER silent_mutation Average:37.562; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0106977787 C -> T LOC_Os01g12660-LOC_Os01g12670 intergenic_region ; MODIFIER silent_mutation Average:37.562; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N
vg0106977787 C -> DEL N N silent_mutation Average:37.562; most accessible tissue: Zhenshan97 panicle, score: 74.671 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106977787 NA 1.86E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 1.06E-10 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 2.57E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 2.96E-06 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 4.24E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 9.03E-07 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 7.39E-07 mr1443 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 1.12E-06 NA mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 7.79E-07 mr1510 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 1.24E-08 9.23E-21 mr1518 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 9.84E-08 3.38E-13 mr1518 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 2.98E-09 mr1533 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 8.92E-11 8.19E-26 mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 5.12E-09 9.31E-15 mr1676 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 2.89E-31 mr1699 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 1.14E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 8.64E-13 7.49E-24 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 2.58E-10 1.24E-29 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 3.76E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 6.39E-12 mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 2.54E-12 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 6.72E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 2.72E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 5.05E-06 mr1398_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 1.85E-12 3.54E-11 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 1.33E-11 4.54E-14 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 7.23E-07 1.58E-23 mr1676_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 4.45E-06 2.72E-13 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 1.84E-18 2.93E-32 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 4.32E-15 6.88E-35 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 3.15E-06 NA mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 1.87E-06 NA mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 NA 1.66E-13 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 2.54E-06 NA mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 1.98E-07 3.44E-09 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106977787 5.23E-06 3.04E-07 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251