\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106964159:

Variant ID: vg0106964159 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6964159
Reference Allele: TAlternative Allele: G
Primary Allele: TSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACGGCCCTATTCTTTTCTCCAACAAAAGTTGGATAAACTTTTAGATAAAAGTGACATGCTTTTCAAACTGCTAAACGGTGCATTTTGTGCGAAAACTTTC[T/G]
ATATAAAAGTTGTTCTAAAGTATCAGATTAATACAAATTTCAAGTTTGTAATAATTAAAACTCAATTAATCACACGTAATTACCACCTCGTTTTGCATGA

Reverse complement sequence

TCATGCAAAACGAGGTGGTAATTACGTGTGATTAATTGAGTTTTAATTATTACAAACTTGAAATTTGTATTAATCTGATACTTTAGAACAACTTTTATAT[A/C]
GAAAGTTTTCGCACAAAATGCACCGTTTAGCAGTTTGAAAAGCATGTCACTTTTATCTAAAAGTTTATCCAACTTTTGTTGGAGAAAAGAATAGGGCCGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.80% 2.70% 0.57% 0.00% NA
All Indica  2759 94.80% 4.50% 0.69% 0.00% NA
All Japonica  1512 99.80% 0.10% 0.13% 0.00% NA
Aus  269 98.50% 0.00% 1.49% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 77.40% 18.90% 3.66% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 95.20% 4.60% 0.25% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.40% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 0.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106964159 T -> G LOC_Os01g12650.1 upstream_gene_variant ; 3461.0bp to feature; MODIFIER silent_mutation Average:42.147; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N
vg0106964159 T -> G LOC_Os01g12640-LOC_Os01g12650 intergenic_region ; MODIFIER silent_mutation Average:42.147; most accessible tissue: Minghui63 panicle, score: 76.913 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106964159 2.54E-08 1.08E-10 mr1310 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 4.35E-14 3.23E-27 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 5.90E-10 3.24E-23 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 5.89E-06 5.89E-06 mr1916 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 4.85E-08 9.38E-13 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 2.04E-11 2.67E-19 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 2.10E-08 1.86E-13 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 1.51E-10 2.07E-21 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 5.52E-09 5.95E-26 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 NA 6.83E-07 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 4.03E-08 6.78E-12 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106964159 3.89E-08 1.66E-14 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251