\
| Variant ID: vg0106964159 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6964159 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACGGCCCTATTCTTTTCTCCAACAAAAGTTGGATAAACTTTTAGATAAAAGTGACATGCTTTTCAAACTGCTAAACGGTGCATTTTGTGCGAAAACTTTC[T/G]
ATATAAAAGTTGTTCTAAAGTATCAGATTAATACAAATTTCAAGTTTGTAATAATTAAAACTCAATTAATCACACGTAATTACCACCTCGTTTTGCATGA
TCATGCAAAACGAGGTGGTAATTACGTGTGATTAATTGAGTTTTAATTATTACAAACTTGAAATTTGTATTAATCTGATACTTTAGAACAACTTTTATAT[A/C]
GAAAGTTTTCGCACAAAATGCACCGTTTAGCAGTTTGAAAAGCATGTCACTTTTATCTAAAAGTTTATCCAACTTTTGTTGGAGAAAAGAATAGGGCCGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 96.80% | 2.70% | 0.57% | 0.00% | NA |
| All Indica | 2759 | 94.80% | 4.50% | 0.69% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 98.50% | 0.00% | 1.49% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 77.40% | 18.90% | 3.66% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.20% | 4.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 0.00% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106964159 | T -> G | LOC_Os01g12650.1 | upstream_gene_variant ; 3461.0bp to feature; MODIFIER | silent_mutation | Average:42.147; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| vg0106964159 | T -> G | LOC_Os01g12640-LOC_Os01g12650 | intergenic_region ; MODIFIER | silent_mutation | Average:42.147; most accessible tissue: Minghui63 panicle, score: 76.913 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106964159 | 2.54E-08 | 1.08E-10 | mr1310 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | 4.35E-14 | 3.23E-27 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | 5.90E-10 | 3.24E-23 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | 5.89E-06 | 5.89E-06 | mr1916 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | 4.85E-08 | 9.38E-13 | mr1925 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | 2.04E-11 | 2.67E-19 | mr1951 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | 2.10E-08 | 1.86E-13 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | 1.51E-10 | 2.07E-21 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | 5.52E-09 | 5.95E-26 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | NA | 6.83E-07 | mr1916_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | 4.03E-08 | 6.78E-12 | mr1925_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106964159 | 3.89E-08 | 1.66E-14 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |