\
| Variant ID: vg0106959667 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6959667 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TAAGGGCCCCTTTCAAACACAGGATAGGAAAAACACAGGAATAGAAAAAATATAGGAATTGAAGTGGTATGTTTTACTAATCCTACATGAATGAAAAACA[C/T]
AGGAAATATAAAGAGGGTCCCTTTGATAGCACCATAGGAAATAAACAAAGCAAATGATAGTTTCCAAGAGGTTGAACCTCTTGCTTATTTTCCTATGAAA
TTTCATAGGAAAATAAGCAAGAGGTTCAACCTCTTGGAAACTATCATTTGCTTTGTTTATTTCCTATGGTGCTATCAAAGGGACCCTCTTTATATTTCCT[G/A]
TGTTTTTCATTCATGTAGGATTAGTAAAACATACCACTTCAATTCCTATATTTTTTCTATTCCTGTGTTTTTCCTATCCTGTGTTTGAAAGGGGCCCTTA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.30% | 6.70% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 98.70% | 1.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 45.40% | 54.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106959667 | C -> T | LOC_Os01g12630.1 | upstream_gene_variant ; 4593.0bp to feature; MODIFIER | silent_mutation | Average:41.985; most accessible tissue: Zhenshan97 flower, score: 65.596 | N | N | N | N |
| vg0106959667 | C -> T | LOC_Os01g12640.1 | upstream_gene_variant ; 922.0bp to feature; MODIFIER | silent_mutation | Average:41.985; most accessible tissue: Zhenshan97 flower, score: 65.596 | N | N | N | N |
| vg0106959667 | C -> T | LOC_Os01g12640.2 | upstream_gene_variant ; 930.0bp to feature; MODIFIER | silent_mutation | Average:41.985; most accessible tissue: Zhenshan97 flower, score: 65.596 | N | N | N | N |
| vg0106959667 | C -> T | LOC_Os01g12640-LOC_Os01g12650 | intergenic_region ; MODIFIER | silent_mutation | Average:41.985; most accessible tissue: Zhenshan97 flower, score: 65.596 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106959667 | NA | 1.14E-06 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106959667 | NA | 6.25E-08 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106959667 | NA | 2.37E-09 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106959667 | NA | 1.19E-17 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106959667 | NA | 7.33E-11 | mr1951 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106959667 | 2.15E-06 | 3.15E-08 | mr1236_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106959667 | 1.14E-09 | 2.94E-12 | mr1498_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106959667 | NA | 2.52E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106959667 | 2.11E-08 | 2.24E-23 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106959667 | NA | 7.17E-07 | mr1951_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |