\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106959667:

Variant ID: vg0106959667 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6959667
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAAGGGCCCCTTTCAAACACAGGATAGGAAAAACACAGGAATAGAAAAAATATAGGAATTGAAGTGGTATGTTTTACTAATCCTACATGAATGAAAAACA[C/T]
AGGAAATATAAAGAGGGTCCCTTTGATAGCACCATAGGAAATAAACAAAGCAAATGATAGTTTCCAAGAGGTTGAACCTCTTGCTTATTTTCCTATGAAA

Reverse complement sequence

TTTCATAGGAAAATAAGCAAGAGGTTCAACCTCTTGGAAACTATCATTTGCTTTGTTTATTTCCTATGGTGCTATCAAAGGGACCCTCTTTATATTTCCT[G/A]
TGTTTTTCATTCATGTAGGATTAGTAAAACATACCACTTCAATTCCTATATTTTTTCTATTCCTGTGTTTTTCCTATCCTGTGTTTGAAAGGGGCCCTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.30% 6.70% 0.00% 0.00% NA
All Indica  2759 100.00% 0.00% 0.00% 0.00% NA
All Japonica  1512 79.60% 20.40% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.90% 0.10% 0.00% 0.00% NA
Temperate Japonica  767 98.70% 1.30% 0.00% 0.00% NA
Tropical Japonica  504 45.40% 54.60% 0.00% 0.00% NA
Japonica Intermediate  241 90.50% 9.50% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 90.00% 10.00% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106959667 C -> T LOC_Os01g12630.1 upstream_gene_variant ; 4593.0bp to feature; MODIFIER silent_mutation Average:41.985; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0106959667 C -> T LOC_Os01g12640.1 upstream_gene_variant ; 922.0bp to feature; MODIFIER silent_mutation Average:41.985; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0106959667 C -> T LOC_Os01g12640.2 upstream_gene_variant ; 930.0bp to feature; MODIFIER silent_mutation Average:41.985; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N
vg0106959667 C -> T LOC_Os01g12640-LOC_Os01g12650 intergenic_region ; MODIFIER silent_mutation Average:41.985; most accessible tissue: Zhenshan97 flower, score: 65.596 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106959667 NA 1.14E-06 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959667 NA 6.25E-08 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959667 NA 2.37E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959667 NA 1.19E-17 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959667 NA 7.33E-11 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959667 2.15E-06 3.15E-08 mr1236_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959667 1.14E-09 2.94E-12 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959667 NA 2.52E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959667 2.11E-08 2.24E-23 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106959667 NA 7.17E-07 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251