Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106949505:

Variant ID: vg0106949505 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6949505
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TAAAACAATTATGTACAACAGTCCAAGATCGGTATAGGCCGTGTTTAGATTCTAACTTTTTTTCTTCGAACTTCTAACTTTTCCGTCACATTAAATGTTT[A/G]
GACACATGTATGGAGCATCAAATGTGGAGGAAAAAACCAATTGCACAGTCCGATTGTAAATTGCGAGATGAATCTTTTGAGCCTAATTGCGCCATGATTT

Reverse complement sequence

AAATCATGGCGCAATTAGGCTCAAAAGATTCATCTCGCAATTTACAATCGGACTGTGCAATTGGTTTTTTCCTCCACATTTGATGCTCCATACATGTGTC[T/C]
AAACATTTAATGTGACGGAAAAGTTAGAAGTTCGAAGAAAAAAAGTTAGAATCTAAACACGGCCTATACCGATCTTGGACTGTTGTACATAATTGTTTTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.70%	28.20%	0.13%	0.00%	NA
All Indica	2759	94.50%	5.40%	0.11%	0.00%	NA
All Japonica	1512	24.50%	75.50%	0.00%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	95.50%	4.50%	0.00%	0.00%	NA
Indica II	465	98.10%	1.70%	0.22%	0.00%	NA
Indica III	913	96.20%	3.70%	0.11%	0.00%	NA
Indica Intermediate	786	89.70%	10.20%	0.13%	0.00%	NA
Temperate Japonica	767	3.30%	96.70%	0.00%	0.00%	NA
Tropical Japonica	504	62.70%	37.30%	0.00%	0.00%	NA
Japonica Intermediate	241	12.40%	87.60%	0.00%	0.00%	NA
VI/Aromatic	96	76.00%	24.00%	0.00%	0.00%	NA
Intermediate	90	74.40%	22.20%	3.33%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106949505	A -> G	LOC_Os01g12610-LOC_Os01g12630	intergenic_region ; MODIFIER	silent_mutation	Average:44.423; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106949505	NA	3.65E-07	mr1129	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	2.64E-08	mr1248	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	2.61E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	3.68E-08	mr1423	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	1.06E-06	mr1443	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	1.94E-09	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	1.00E-42	mr1533	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	8.64E-10	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	8.48E-06	5.56E-24	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	2.85E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	5.97E-19	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	7.29E-09	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	1.17E-36	mr1980	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	2.78E-13	mr1982	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	3.56E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	9.19E-10	5.93E-12	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	4.76E-42	mr1533_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	8.23E-07	mr1553_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	1.72E-25	mr1653_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	4.23E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	2.13E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	5.06E-06	8.82E-20	mr1699_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	2.50E-09	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	4.04E-06	NA	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	2.69E-09	5.53E-23	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106949505	NA	1.70E-06	mr1951_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251