| Variant ID: vg0106949505 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6949505 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAAAACAATTATGTACAACAGTCCAAGATCGGTATAGGCCGTGTTTAGATTCTAACTTTTTTTCTTCGAACTTCTAACTTTTCCGTCACATTAAATGTTT[A/G]
GACACATGTATGGAGCATCAAATGTGGAGGAAAAAACCAATTGCACAGTCCGATTGTAAATTGCGAGATGAATCTTTTGAGCCTAATTGCGCCATGATTT
AAATCATGGCGCAATTAGGCTCAAAAGATTCATCTCGCAATTTACAATCGGACTGTGCAATTGGTTTTTTCCTCCACATTTGATGCTCCATACATGTGTC[T/C]
AAACATTTAATGTGACGGAAAAGTTAGAAGTTCGAAGAAAAAAAGTTAGAATCTAAACACGGCCTATACCGATCTTGGACTGTTGTACATAATTGTTTTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.70% | 28.20% | 0.13% | 0.00% | NA |
| All Indica | 2759 | 94.50% | 5.40% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 24.50% | 75.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 95.50% | 4.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.10% | 1.70% | 0.22% | 0.00% | NA |
| Indica III | 913 | 96.20% | 3.70% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 89.70% | 10.20% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 62.70% | 37.30% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 12.40% | 87.60% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 76.00% | 24.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 74.40% | 22.20% | 3.33% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106949505 | A -> G | LOC_Os01g12610-LOC_Os01g12630 | intergenic_region ; MODIFIER | silent_mutation | Average:44.423; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106949505 | NA | 3.65E-07 | mr1129 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106949505 | NA | 2.64E-08 | mr1248 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106949505 | NA | 2.61E-06 | mr1364 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106949505 | NA | 3.68E-08 | mr1423 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106949505 | NA | 1.06E-06 | mr1443 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106949505 | NA | 1.94E-09 | mr1518 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106949505 | NA | 1.00E-42 | mr1533 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106949505 | NA | 8.64E-10 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106949505 | 8.48E-06 | 5.56E-24 | mr1699 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106949505 | NA | 2.85E-08 | mr1746 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China
Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/