Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106926624:

Variant ID: vg0106926624 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6926624
Reference Allele: C	Alternative Allele: A,T
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

TAAACTCCTATCATCTAGCCACCTGGGCCGACAGTGCCAAGACTCGGAATCCTACTGGGCCAGGTTCTTCCCATGAGAACATGTGGTTGCACGTTAGGCT[C/A,T]
AGATCCATGACTTATGAAGTGAAGTCCTTAATTGACCAAGACAACTTGCCAAACTACAATAGCACACAGCTCAACAGTAGGCTCACACAGAGACCGTACC

Reverse complement sequence

GGTACGGTCTCTGTGTGAGCCTACTGTTGAGCTGTGTGCTATTGTAGTTTGGCAAGTTGTCTTGGTCAATTAAGGACTTCACTTCATAAGTCATGGATCT[G/T,A]
AGCCTAACGTGCAACCACATGTTCTCATGGGAAGAACCTGGCCCAGTAGGATTCCGAGTCTTGGCACTGTCGGCCCAGGTGGCTAGATGATAGGAGTTTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.00%	35.70%	15.79%	4.30%	T: 1.23%
All Indica	2759	19.60%	52.20%	20.95%	7.25%	NA
All Japonica	1512	72.40%	13.80%	9.99%	0.07%	T: 3.84%
Aus	269	98.50%	0.40%	0.74%	0.37%	NA
Indica I	595	8.70%	57.30%	29.58%	4.37%	NA
Indica II	465	27.10%	54.00%	13.98%	4.95%	NA
Indica III	913	18.60%	49.40%	20.26%	11.72%	NA
Indica Intermediate	786	24.40%	50.60%	19.34%	5.60%	NA
Temperate Japonica	767	87.40%	2.30%	4.04%	0.00%	T: 6.26%
Tropical Japonica	504	44.20%	34.90%	20.63%	0.00%	T: 0.20%
Japonica Intermediate	241	83.40%	5.80%	6.64%	0.41%	T: 3.73%
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	44.40%	38.90%	15.56%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106926624	C -> T	LOC_Os01g12580.1	upstream_gene_variant ; 3288.0bp to feature; MODIFIER	silent_mutation	Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg0106926624	C -> T	LOC_Os01g12590.1	upstream_gene_variant ; 1377.0bp to feature; MODIFIER	silent_mutation	Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg0106926624	C -> T	LOC_Os01g12580-LOC_Os01g12590	intergenic_region ; MODIFIER	silent_mutation	Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg0106926624	C -> A	LOC_Os01g12580.1	upstream_gene_variant ; 3288.0bp to feature; MODIFIER	silent_mutation	Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg0106926624	C -> A	LOC_Os01g12590.1	upstream_gene_variant ; 1377.0bp to feature; MODIFIER	silent_mutation	Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg0106926624	C -> A	LOC_Os01g12580-LOC_Os01g12590	intergenic_region ; MODIFIER	silent_mutation	Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N
vg0106926624	C -> DEL	N	N	silent_mutation	Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106926624	NA	1.10E-08	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	1.08E-08	2.43E-14	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	3.01E-09	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	6.06E-09	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	8.88E-10	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	6.39E-14	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	1.63E-06	6.17E-10	mr1925	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	3.28E-07	5.10E-10	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	2.94E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	3.03E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	3.66E-12	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	7.55E-06	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	2.43E-10	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	4.00E-13	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	6.68E-15	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	1.43E-07	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624	NA	6.21E-08	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251