\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106926624:

Variant ID: vg0106926624 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6926624
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, A: 0.02, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


TAAACTCCTATCATCTAGCCACCTGGGCCGACAGTGCCAAGACTCGGAATCCTACTGGGCCAGGTTCTTCCCATGAGAACATGTGGTTGCACGTTAGGCT[C/A,T]
AGATCCATGACTTATGAAGTGAAGTCCTTAATTGACCAAGACAACTTGCCAAACTACAATAGCACACAGCTCAACAGTAGGCTCACACAGAGACCGTACC

Reverse complement sequence

GGTACGGTCTCTGTGTGAGCCTACTGTTGAGCTGTGTGCTATTGTAGTTTGGCAAGTTGTCTTGGTCAATTAAGGACTTCACTTCATAAGTCATGGATCT[G/T,A]
AGCCTAACGTGCAACCACATGTTCTCATGGGAAGAACCTGGCCCAGTAGGATTCCGAGTCTTGGCACTGTCGGCCCAGGTGGCTAGATGATAGGAGTTTA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.00% 35.70% 15.79% 4.30% T: 1.23%
All Indica  2759 19.60% 52.20% 20.95% 7.25% NA
All Japonica  1512 72.40% 13.80% 9.99% 0.07% T: 3.84%
Aus  269 98.50% 0.40% 0.74% 0.37% NA
Indica I  595 8.70% 57.30% 29.58% 4.37% NA
Indica II  465 27.10% 54.00% 13.98% 4.95% NA
Indica III  913 18.60% 49.40% 20.26% 11.72% NA
Indica Intermediate  786 24.40% 50.60% 19.34% 5.60% NA
Temperate Japonica  767 87.40% 2.30% 4.04% 0.00% T: 6.26%
Tropical Japonica  504 44.20% 34.90% 20.63% 0.00% T: 0.20%
Japonica Intermediate  241 83.40% 5.80% 6.64% 0.41% T: 3.73%
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 44.40% 38.90% 15.56% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106926624 C -> T LOC_Os01g12580.1 upstream_gene_variant ; 3288.0bp to feature; MODIFIER silent_mutation Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0106926624 C -> T LOC_Os01g12590.1 upstream_gene_variant ; 1377.0bp to feature; MODIFIER silent_mutation Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0106926624 C -> T LOC_Os01g12580-LOC_Os01g12590 intergenic_region ; MODIFIER silent_mutation Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0106926624 C -> A LOC_Os01g12580.1 upstream_gene_variant ; 3288.0bp to feature; MODIFIER silent_mutation Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0106926624 C -> A LOC_Os01g12590.1 upstream_gene_variant ; 1377.0bp to feature; MODIFIER silent_mutation Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0106926624 C -> A LOC_Os01g12580-LOC_Os01g12590 intergenic_region ; MODIFIER silent_mutation Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N
vg0106926624 C -> DEL N N silent_mutation Average:45.81; most accessible tissue: Zhenshan97 flag leaf, score: 65.3 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106926624 NA 1.10E-08 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 1.08E-08 2.43E-14 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 3.01E-09 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 6.06E-09 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 8.88E-10 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 6.39E-14 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 1.63E-06 6.17E-10 mr1925 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 3.28E-07 5.10E-10 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 2.94E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 3.03E-08 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 3.66E-12 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 7.55E-06 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 2.43E-10 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 4.00E-13 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 6.68E-15 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 1.43E-07 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106926624 NA 6.21E-08 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251