\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106883091:

Variant ID: vg0106883091 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6883091
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 104. )

Flanking Sequence (100 bp) in Reference Genome:


TGGCAATTTGGCATTTGGCATTTGCTAGTCCATAGTAGCAAATTGTGCCAAAAAGTGCTTTGGGACCACTCCCTCTCTCTTTCTCTCTCTCACTTTAGTG[C/T]
TAGAATGGCAAAACTTTAACATGCATCTAAACACCAACTAGTACTTTTGCAATGCTAAAACTTTTGCCACTAAAACTTTTGCCATTTGTCATTTGCCATT

Reverse complement sequence

AATGGCAAATGACAAATGGCAAAAGTTTTAGTGGCAAAAGTTTTAGCATTGCAAAAGTACTAGTTGGTGTTTAGATGCATGTTAAAGTTTTGCCATTCTA[G/A]
CACTAAAGTGAGAGAGAGAAAGAGAGAGGGAGTGGTCCCAAAGCACTTTTTGGCACAATTTGCTACTATGGACTAGCAAATGCCAAATGCCAAATTGCCA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.20% 48.80% 0.00% 0.00% NA
All Indica  2759 84.40% 15.60% 0.00% 0.00% NA
All Japonica  1512 2.90% 97.10% 0.00% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 73.30% 26.70% 0.00% 0.00% NA
Indica III  913 89.40% 10.60% 0.00% 0.00% NA
Indica Intermediate  786 77.70% 22.30% 0.00% 0.00% NA
Temperate Japonica  767 1.70% 98.30% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 2.10% 97.90% 0.00% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 46.70% 53.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106883091 C -> T LOC_Os01g12520.1 upstream_gene_variant ; 1123.0bp to feature; MODIFIER silent_mutation Average:57.755; most accessible tissue: Zhenshan97 flower, score: 89.548 N N N N
vg0106883091 C -> T LOC_Os01g12520-LOC_Os01g12530 intergenic_region ; MODIFIER silent_mutation Average:57.755; most accessible tissue: Zhenshan97 flower, score: 89.548 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106883091 NA 1.47E-10 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106883091 NA 7.75E-11 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106883091 NA 3.67E-16 mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106883091 9.24E-06 NA mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106883091 1.15E-06 1.52E-10 mr1951 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106883091 NA 6.58E-07 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106883091 NA 1.74E-12 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106883091 NA 2.84E-07 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251