\
| Variant ID: vg0106883091 (JBrowse) | Variation Type: SNP |
| Chromosome: chr01 | Position: 6883091 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.05, others allele: 0.00, population size: 104. )
TGGCAATTTGGCATTTGGCATTTGCTAGTCCATAGTAGCAAATTGTGCCAAAAAGTGCTTTGGGACCACTCCCTCTCTCTTTCTCTCTCTCACTTTAGTG[C/T]
TAGAATGGCAAAACTTTAACATGCATCTAAACACCAACTAGTACTTTTGCAATGCTAAAACTTTTGCCACTAAAACTTTTGCCATTTGTCATTTGCCATT
AATGGCAAATGACAAATGGCAAAAGTTTTAGTGGCAAAAGTTTTAGCATTGCAAAAGTACTAGTTGGTGTTTAGATGCATGTTAAAGTTTTGCCATTCTA[G/A]
CACTAAAGTGAGAGAGAGAAAGAGAGAGGGAGTGGTCCCAAAGCACTTTTTGGCACAATTTGCTACTATGGACTAGCAAATGCCAAATGCCAAATTGCCA
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.20% | 48.80% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 2.90% | 97.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 0.70% | 99.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 94.10% | 5.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 73.30% | 26.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 89.40% | 10.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 77.70% | 22.30% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 53.30% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0106883091 | C -> T | LOC_Os01g12520.1 | upstream_gene_variant ; 1123.0bp to feature; MODIFIER | silent_mutation | Average:57.755; most accessible tissue: Zhenshan97 flower, score: 89.548 | N | N | N | N |
| vg0106883091 | C -> T | LOC_Os01g12520-LOC_Os01g12530 | intergenic_region ; MODIFIER | silent_mutation | Average:57.755; most accessible tissue: Zhenshan97 flower, score: 89.548 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0106883091 | NA | 1.47E-10 | mr1498 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106883091 | NA | 7.75E-11 | mr1769 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106883091 | NA | 3.67E-16 | mr1916 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106883091 | 9.24E-06 | NA | mr1951 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106883091 | 1.15E-06 | 1.52E-10 | mr1951 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106883091 | NA | 6.58E-07 | mr1498_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106883091 | NA | 1.74E-12 | mr1769_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0106883091 | NA | 2.84E-07 | mr1951_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |