Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106874407:

Variant ID: vg0106874407 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6874407
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TTTTTTTCCTTCCTAAACACGTGAGCTTAAGCGTCACACTCATCCTTTATGAATAAGCATATGCATATCATATTTATATGAGCATTTTTTACACTGGATC[T/A]
GTATATACAAATGTCTCACTTTCGATATCTACGACGGAAAGAAAATCAACTGTAAACATGAGTCATCGTGTTAAGAATAGGACTTTGAACATAAATGGAT

Reverse complement sequence

ATCCATTTATGTTCAAAGTCCTATTCTTAACACGATGACTCATGTTTACAGTTGATTTTCTTTCCGTCGTAGATATCGAAAGTGAGACATTTGTATATAC[A/T]
GATCCAGTGTAAAAAATGCTCATATAAATATGATATGCATATGCTTATTCATAAAGGATGAGTGTGACGCTTAAGCTCACGTGTTTAGGAAGGAAAAAAA

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	56.50%	43.50%	0.02%	0.00%	NA
All Indica	2759	89.90%	10.10%	0.00%	0.00%	NA
All Japonica	1512	9.40%	90.50%	0.07%	0.00%	NA
Aus	269	0.70%	99.30%	0.00%	0.00%	NA
Indica I	595	99.30%	0.70%	0.00%	0.00%	NA
Indica II	465	75.50%	24.50%	0.00%	0.00%	NA
Indica III	913	95.00%	5.00%	0.00%	0.00%	NA
Indica Intermediate	786	85.40%	14.60%	0.00%	0.00%	NA
Temperate Japonica	767	11.50%	88.50%	0.00%	0.00%	NA
Tropical Japonica	504	5.80%	94.20%	0.00%	0.00%	NA
Japonica Intermediate	241	10.40%	89.20%	0.41%	0.00%	NA
VI/Aromatic	96	3.10%	96.90%	0.00%	0.00%	NA
Intermediate	90	48.90%	51.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106874407	T -> A	LOC_Os01g12510.1	downstream_gene_variant ; 1481.0bp to feature; MODIFIER	silent_mutation	Average:77.817; most accessible tissue: Minghui63 flower, score: 84.49	N	N	N	N
vg0106874407	T -> A	LOC_Os01g12500-LOC_Os01g12510	intergenic_region ; MODIFIER	silent_mutation	Average:77.817; most accessible tissue: Minghui63 flower, score: 84.49	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106874407	NA	5.64E-06	mr1088	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	1.49E-06	NA	mr1207	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	6.22E-16	1.02E-08	mr1498	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	2.02E-22	2.45E-37	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	NA	1.36E-21	mr1598	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	1.11E-10	NA	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	5.33E-14	6.26E-32	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	NA	1.21E-06	mr1881	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	1.25E-08	2.85E-23	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	2.99E-08	2.99E-08	mr1916	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	9.73E-09	NA	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	7.30E-11	8.29E-16	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	NA	3.55E-24	mr1943	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	4.85E-10	NA	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	1.07E-16	1.20E-24	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	4.33E-07	6.34E-13	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	NA	7.48E-17	mr1457_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	5.58E-13	NA	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	4.58E-18	1.03E-31	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	2.42E-08	NA	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	7.93E-20	4.30E-40	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	4.26E-06	7.53E-29	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	1.17E-10	5.83E-13	mr1916_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	4.46E-10	NA	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	6.74E-12	2.54E-16	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	NA	2.15E-27	mr1943_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	3.13E-07	NA	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106874407	2.01E-11	2.09E-19	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251