Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106836437:

Variant ID: vg0106836437 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6836437
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTCACTAATCAAATATTAGACTTAACAGTTTTCACCCTTTAAACTTCCATTTCTCTACCAACAATTCCTCCGAACCAAACTGGGCGAACTTTCATTTCA[C/T]
TACTAACAATCCAAAAACCGTTAGTTTGATTGCTTCAAGCCTTTGTTGGGCTTTGTACTCAGCCAATGTTTACTATTATATGATTATAACGCCGCGATTA

Reverse complement sequence

TAATCGCGGCGTTATAATCATATAATAGTAAACATTGGCTGAGTACAAAGCCCAACAAAGGCTTGAAGCAATCAAACTAACGGTTTTTGGATTGTTAGTA[G/A]
TGAAATGAAAGTTCGCCCAGTTTGGTTCGGAGGAATTGTTGGTAGAGAAATGGAAGTTTAAAGGGTGAAAACTGTTAAGTCTAATATTTGATTAGTGAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 54.60% 45.40% 0.04% 0.00% NA
All Indica  2759 89.90% 10.10% 0.00% 0.00% NA
All Japonica  1512 3.40% 96.40% 0.13% 0.00% NA
Aus  269 0.70% 99.30% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 76.10% 23.90% 0.00% 0.00% NA
Indica III  913 95.00% 5.00% 0.00% 0.00% NA
Indica Intermediate  786 85.00% 15.00% 0.00% 0.00% NA
Temperate Japonica  767 1.80% 98.20% 0.00% 0.00% NA
Tropical Japonica  504 5.20% 94.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.00% 94.20% 0.83% 0.00% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 47.80% 52.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106836437 C -> T LOC_Os01g12460.1 upstream_gene_variant ; 3667.0bp to feature; MODIFIER silent_mutation Average:84.077; most accessible tissue: Callus, score: 93.759 N N N N
vg0106836437 C -> T LOC_Os01g12470.1 upstream_gene_variant ; 683.0bp to feature; MODIFIER silent_mutation Average:84.077; most accessible tissue: Callus, score: 93.759 N N N N
vg0106836437 C -> T LOC_Os01g12464.1 downstream_gene_variant ; 1137.0bp to feature; MODIFIER silent_mutation Average:84.077; most accessible tissue: Callus, score: 93.759 N N N N
vg0106836437 C -> T LOC_Os01g12464-LOC_Os01g12470 intergenic_region ; MODIFIER silent_mutation Average:84.077; most accessible tissue: Callus, score: 93.759 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106836437 C T -0.02 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106836437 NA 3.70E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 2.09E-06 NA mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 2.49E-06 NA mr1207 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 9.48E-13 5.24E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 9.33E-18 3.65E-32 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 NA 1.02E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 NA 2.67E-21 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 NA 6.29E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 3.04E-10 NA mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 3.92E-13 1.57E-30 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 NA 5.08E-06 mr1881 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 4.53E-11 9.11E-25 mr1916 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 3.95E-08 3.95E-08 mr1916 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 1.24E-07 NA mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 1.79E-09 2.30E-14 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 NA 2.80E-23 mr1943 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 NA 5.46E-10 mr1945 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 5.05E-11 NA mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 5.70E-15 8.15E-23 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 3.43E-07 4.44E-13 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 NA 1.02E-17 mr1457_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 2.20E-12 NA mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 6.01E-15 1.17E-27 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 NA 1.36E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 1.24E-09 NA mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 8.07E-16 1.04E-34 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 2.19E-09 1.07E-31 mr1916_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 1.91E-10 1.05E-12 mr1916_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 2.33E-08 NA mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 1.57E-10 7.75E-15 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 NA 2.81E-27 mr1943_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 4.19E-06 NA mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106836437 1.79E-10 4.78E-18 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251