Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0106827714:

Variant ID: vg0106827714 (JBrowse)	Variation Type: INDEL
Chromosome: chr01	Position: 6827714
Reference Allele: CAAA	Alternative Allele: TAAA,CAAAA,C,AAAA,CAA,CAAAAA
Primary Allele: TAAA	Secondary Allele: CAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GATATGATGTGATGAAAAGTTGGGAACAGGGGAAACCAAGCACGGCCTAGACCTACTCGTACTTTCACTCCTCGGGCTCTGCGTGAAGTACTCCCTCCGT[CAAA/TAAA,CAAAA,C,AAAA,CAA,CAAAAA]
AAAAAAAAAAGAAGACAAACACTATGTTTCAATGTCCAACGTTTGACCATTTGTCTTATTTAAAAAAATATGAAAAAAAATTAAAAAGATAAGTCACACA

Reverse complement sequence

TGTGTGACTTATCTTTTTAATTTTTTTTCATATTTTTTTAAATAAGACAAATGGTCAAACGTTGGACATTGAAACATAGTGTTTGTCTTCTTTTTTTTTT[TTTG/TTTA,TTTTG,G,TTTT,TTG,TTTTTG]
ACGGAGGGAGTACTTCACGCAGAGCCCGAGGAGTGAAAGTACGAGTAGGTCTAGGCCGTGCTTGGTTTCCCCTGTTCCCAACTTTTCATCACATCATATC

Allele Frequencies:

Populations	Population Size	Frequency of TAAA(primary allele)	Frequency of CAAA(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	58.10%	4.40%	17.31%	13.31%	CAAAA: 3.13%; C: 1.52%; AAAA: 1.23%; CAA: 0.78%; CAAAAA: 0.23%
All Indica	2759	82.20%	0.60%	6.31%	8.88%	AAAA: 1.85%; CAA: 0.11%; CAAAA: 0.07%; C: 0.04%
All Japonica	1512	27.90%	11.80%	36.31%	7.87%	CAAAA: 9.52%; C: 3.90%; CAA: 1.98%; CAAAAA: 0.73%
Aus	269	0.70%	0.70%	22.68%	73.98%	AAAA: 1.86%
Indica I	595	88.70%	0.30%	6.55%	3.03%	AAAA: 1.34%
Indica II	465	77.20%	0.40%	1.08%	20.00%	AAAA: 1.29%
Indica III	913	90.60%	0.30%	2.63%	5.37%	AAAA: 0.99%; C: 0.11%
Indica Intermediate	786	70.40%	1.10%	13.49%	10.81%	AAAA: 3.56%; CAA: 0.38%; CAAAA: 0.25%
Temperate Japonica	767	3.10%	15.30%	57.11%	10.82%	CAAAA: 12.91%; CAAAAA: 0.52%; CAA: 0.26%
Tropical Japonica	504	59.50%	6.70%	8.33%	4.56%	C: 10.91%; CAAAA: 5.16%; CAA: 3.37%; CAAAAA: 1.39%
Japonica Intermediate	241	40.70%	11.20%	28.63%	5.39%	CAAAA: 7.88%; CAA: 4.56%; C: 1.66%
VI/Aromatic	96	3.10%	7.30%	16.67%	57.29%	C: 11.46%; AAAA: 2.08%; CAA: 2.08%
Intermediate	90	56.70%	5.60%	20.00%	12.22%	CAAAA: 2.22%; CAA: 2.22%; C: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106827714	CAAA -> TAAA	LOC_Os01g12460.1	downstream_gene_variant ; 2390.0bp to feature; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> TAAA	LOC_Os01g12440-LOC_Os01g12460	intergenic_region ; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> CAAAA	LOC_Os01g12460.1	downstream_gene_variant ; 2386.0bp to feature; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> CAAAA	LOC_Os01g12440-LOC_Os01g12460	intergenic_region ; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> CAA	LOC_Os01g12460.1	downstream_gene_variant ; 2387.0bp to feature; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> CAA	LOC_Os01g12440-LOC_Os01g12460	intergenic_region ; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> C	LOC_Os01g12460.1	downstream_gene_variant ; 2389.0bp to feature; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> C	LOC_Os01g12440-LOC_Os01g12460	intergenic_region ; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> CAAAAA	LOC_Os01g12460.1	downstream_gene_variant ; 2386.0bp to feature; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> CAAAAA	LOC_Os01g12440-LOC_Os01g12460	intergenic_region ; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> DEL	N	N	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> AAAA	LOC_Os01g12460.1	downstream_gene_variant ; 2390.0bp to feature; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N
vg0106827714	CAAA -> AAAA	LOC_Os01g12440-LOC_Os01g12460	intergenic_region ; MODIFIER	silent_mutation	Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0106827714	CAAA	AAAA	-0.03	-0.02	-0.04	-0.01	-0.03	-0.04
vg0106827714	CAAA	C	-0.02	0.18	0.23	-0.02	-0.04	-0.05
vg0106827714	CAAA	CAA	-0.02	-0.05	-0.07	-0.09	-0.11	-0.11
vg0106827714	CAAA	CAAAA	-0.16	-0.24	-0.19	-0.11	-0.2	-0.22
vg0106827714	CAAA	CAAAA*	-0.26	-0.32	-0.28	-0.18	-0.28	-0.25
vg0106827714	CAAA	TAAA	-0.02	-0.03	-0.04	-0.01	-0.03	-0.04

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106827714	NA	3.85E-10	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	1.19E-09	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	8.83E-08	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	8.06E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	3.32E-11	mr1457	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	3.67E-09	1.20E-12	mr1498	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	3.05E-09	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	3.18E-10	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	8.74E-16	mr1699	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	6.48E-08	mr1746	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	6.59E-08	1.20E-11	mr1769	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	4.46E-17	2.91E-30	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	3.16E-07	mr1925	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	8.98E-07	mr1925	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	8.06E-11	5.67E-10	mr1951	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	8.07E-06	3.15E-11	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	2.71E-06	mr1236_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	2.47E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	9.97E-22	mr1457_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	1.10E-11	mr1498_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	3.51E-13	5.66E-16	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	1.00E-09	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	1.79E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	2.21E-06	mr1754_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	3.80E-08	7.63E-16	mr1769_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	2.12E-25	5.13E-43	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	3.36E-07	mr1925_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	1.16E-06	mr1943_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	NA	9.53E-09	mr1951_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714	1.55E-09	4.58E-10	mr1951_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251