\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106827714:

Variant ID: vg0106827714 (JBrowse)Variation Type: INDEL
Chromosome: chr01Position: 6827714
Reference Allele: CAAAAlternative Allele: TAAA,CAAAA,C,AAAA,CAA,CAAAAA
Primary Allele: TAAASecondary Allele: CAAA

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GATATGATGTGATGAAAAGTTGGGAACAGGGGAAACCAAGCACGGCCTAGACCTACTCGTACTTTCACTCCTCGGGCTCTGCGTGAAGTACTCCCTCCGT[CAAA/TAAA,CAAAA,C,AAAA,CAA,CAAAAA]
AAAAAAAAAAGAAGACAAACACTATGTTTCAATGTCCAACGTTTGACCATTTGTCTTATTTAAAAAAATATGAAAAAAAATTAAAAAGATAAGTCACACA

Reverse complement sequence

TGTGTGACTTATCTTTTTAATTTTTTTTCATATTTTTTTAAATAAGACAAATGGTCAAACGTTGGACATTGAAACATAGTGTTTGTCTTCTTTTTTTTTT[TTTG/TTTA,TTTTG,G,TTTT,TTG,TTTTTG]
ACGGAGGGAGTACTTCACGCAGAGCCCGAGGAGTGAAAGTACGAGTAGGTCTAGGCCGTGCTTGGTTTCCCCTGTTCCCAACTTTTCATCACATCATATC

Allele Frequencies:

Populations Population SizeFrequency of TAAA(primary allele) Frequency of CAAA(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.10% 4.40% 17.31% 13.31% CAAAA: 3.13%; C: 1.52%; AAAA: 1.23%; CAA: 0.78%; CAAAAA: 0.23%
All Indica  2759 82.20% 0.60% 6.31% 8.88% AAAA: 1.85%; CAA: 0.11%; CAAAA: 0.07%; C: 0.04%
All Japonica  1512 27.90% 11.80% 36.31% 7.87% CAAAA: 9.52%; C: 3.90%; CAA: 1.98%; CAAAAA: 0.73%
Aus  269 0.70% 0.70% 22.68% 73.98% AAAA: 1.86%
Indica I  595 88.70% 0.30% 6.55% 3.03% AAAA: 1.34%
Indica II  465 77.20% 0.40% 1.08% 20.00% AAAA: 1.29%
Indica III  913 90.60% 0.30% 2.63% 5.37% AAAA: 0.99%; C: 0.11%
Indica Intermediate  786 70.40% 1.10% 13.49% 10.81% AAAA: 3.56%; CAA: 0.38%; CAAAA: 0.25%
Temperate Japonica  767 3.10% 15.30% 57.11% 10.82% CAAAA: 12.91%; CAAAAA: 0.52%; CAA: 0.26%
Tropical Japonica  504 59.50% 6.70% 8.33% 4.56% C: 10.91%; CAAAA: 5.16%; CAA: 3.37%; CAAAAA: 1.39%
Japonica Intermediate  241 40.70% 11.20% 28.63% 5.39% CAAAA: 7.88%; CAA: 4.56%; C: 1.66%
VI/Aromatic  96 3.10% 7.30% 16.67% 57.29% C: 11.46%; AAAA: 2.08%; CAA: 2.08%
Intermediate  90 56.70% 5.60% 20.00% 12.22% CAAAA: 2.22%; CAA: 2.22%; C: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106827714 CAAA -> TAAA LOC_Os01g12460.1 downstream_gene_variant ; 2390.0bp to feature; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> TAAA LOC_Os01g12440-LOC_Os01g12460 intergenic_region ; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> CAAAA LOC_Os01g12460.1 downstream_gene_variant ; 2386.0bp to feature; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> CAAAA LOC_Os01g12440-LOC_Os01g12460 intergenic_region ; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> CAA LOC_Os01g12460.1 downstream_gene_variant ; 2387.0bp to feature; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> CAA LOC_Os01g12440-LOC_Os01g12460 intergenic_region ; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> C LOC_Os01g12460.1 downstream_gene_variant ; 2389.0bp to feature; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> C LOC_Os01g12440-LOC_Os01g12460 intergenic_region ; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> CAAAAA LOC_Os01g12460.1 downstream_gene_variant ; 2386.0bp to feature; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> CAAAAA LOC_Os01g12440-LOC_Os01g12460 intergenic_region ; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> DEL N N silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> AAAA LOC_Os01g12460.1 downstream_gene_variant ; 2390.0bp to feature; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N
vg0106827714 CAAA -> AAAA LOC_Os01g12440-LOC_Os01g12460 intergenic_region ; MODIFIER silent_mutation Average:71.83; most accessible tissue: Zhenshan97 panicle, score: 93.558 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106827714 CAAA AAAA -0.03 -0.02 -0.04 -0.01 -0.03 -0.04
vg0106827714 CAAA C -0.02 0.18 0.23 -0.02 -0.04 -0.05
vg0106827714 CAAA CAA -0.02 -0.05 -0.07 -0.09 -0.11 -0.11
vg0106827714 CAAA CAAAA -0.16 -0.24 -0.19 -0.11 -0.2 -0.22
vg0106827714 CAAA CAAAA* -0.26 -0.32 -0.28 -0.18 -0.28 -0.25
vg0106827714 CAAA TAAA -0.02 -0.03 -0.04 -0.01 -0.03 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106827714 NA 3.85E-10 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 1.19E-09 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 8.83E-08 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 8.06E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 3.32E-11 mr1457 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 3.67E-09 1.20E-12 mr1498 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 3.05E-09 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 3.18E-10 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 8.74E-16 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 6.48E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 6.59E-08 1.20E-11 mr1769 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 4.46E-17 2.91E-30 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 3.16E-07 mr1925 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 8.98E-07 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 8.06E-11 5.67E-10 mr1951 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 8.07E-06 3.15E-11 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 2.71E-06 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 2.47E-08 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 9.97E-22 mr1457_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 1.10E-11 mr1498_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 3.51E-13 5.66E-16 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 1.00E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 1.79E-08 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 2.21E-06 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 3.80E-08 7.63E-16 mr1769_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 2.12E-25 5.13E-43 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 3.36E-07 mr1925_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 1.16E-06 mr1943_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 NA 9.53E-09 mr1951_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106827714 1.55E-09 4.58E-10 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251