Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0106826782:

Variant ID: vg0106826782 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6826782
Reference Allele: GAlternative Allele: T
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGGTCGGCAAATGGCAACATTATTGGTTGCTAGCTAGCTCTCCGTCCTTCCGGTTTGCAGGACGTGGGCTCCATCTACACGGCGACAACGTCGCGGTC[G/T]
CCGGCGCCGCGGCGGGGTCCGGAGTCCGGACCGGGCGCGATGGGTGGTACGTGCGGTGCGGGTCACGGCGGCGCTATGAAGCTAGGAGGAGGTCACGGCG

Reverse complement sequence

CGCCGTGACCTCCTCCTAGCTTCATAGCGCCGCCGTGACCCGCACCGCACGTACCACCCATCGCGCCCGGTCCGGACTCCGGACCCCGCCGCGGCGCCGG[C/A]
GACCGCGACGTTGTCGCCGTGTAGATGGAGCCCACGTCCTGCAAACCGGAAGGACGGAGAGCTAGCTAGCAACCAATAATGTTGCCATTTGCCGACCAAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 9.10% 0.02% 0.00% NA
All Indica  2759 98.50% 1.50% 0.00% 0.00% NA
All Japonica  1512 75.00% 24.90% 0.07% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 98.80% 1.20% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 3.60% 0.00% 0.00% NA
Temperate Japonica  767 98.30% 1.70% 0.00% 0.00% NA
Tropical Japonica  504 45.80% 54.00% 0.20% 0.00% NA
Japonica Intermediate  241 61.80% 38.20% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 88.90% 11.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106826782 G -> T LOC_Os01g12460.1 downstream_gene_variant ; 3322.0bp to feature; MODIFIER silent_mutation Average:90.244; most accessible tissue: Zhenshan97 panicle, score: 98.572 N N N N
vg0106826782 G -> T LOC_Os01g12440-LOC_Os01g12460 intergenic_region ; MODIFIER silent_mutation Average:90.244; most accessible tissue: Zhenshan97 panicle, score: 98.572 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0106826782 G T -0.14 -0.19 -0.12 -0.05 -0.09 -0.1

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106826782 NA 7.69E-09 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 NA 5.05E-08 mr1236 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 NA 2.21E-10 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 3.71E-08 3.54E-07 mr1498 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 NA 1.83E-09 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 3.56E-06 NA mr1676 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 NA 7.48E-11 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 1.83E-22 7.70E-29 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 1.02E-19 1.68E-38 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 6.81E-06 NA mr1916 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 NA 3.61E-08 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 1.22E-07 1.35E-06 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 NA 8.85E-08 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 7.10E-08 1.56E-12 mr1951 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 5.82E-07 1.21E-14 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 7.75E-06 1.98E-07 mr1236_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 NA 4.64E-07 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 1.11E-14 2.56E-12 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 2.35E-14 2.68E-17 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 NA 2.96E-10 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 4.69E-32 4.20E-41 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 3.12E-29 1.82E-55 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 6.83E-07 NA mr1916_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 NA 6.80E-12 mr1916_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 3.81E-08 NA mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 4.68E-10 1.00E-10 mr1951_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106826782 1.36E-09 1.43E-10 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251