\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106825030:

Variant ID: vg0106825030 (JBrowse)Variation Type: SNP
Chromosome: chr01Position: 6825030
Reference Allele: CAlternative Allele: A,G
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACTTTTGTGATTACTATTTGAGAGTATAAACGAGTACATTAACTACTACGAAGTTGAAAGATTGCTTTTCGAAAAGTACTACTGCAAGAATAGGTTATTT[C/A,G]
GAAAAGTACTACTACGGAGTTTGAGATGCAAAGATGTTTTATGTATCCTTGAGCTAGCCATACGGACTATACTGTTCTAAAATATAATAACTTTTCCCCT

Reverse complement sequence

AGGGGAAAAGTTATTATATTTTAGAACAGTATAGTCCGTATGGCTAGCTCAAGGATACATAAAACATCTTTGCATCTCAAACTCCGTAGTAGTACTTTTC[G/T,C]
AAATAACCTATTCTTGCAGTAGTACTTTTCGAAAAGCAATCTTTCAACTTCGTAGTAGTTAATGTACTCGTTTATACTCTCAAATAGTAATCACAAAAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 24.10% 0.02% 0.00% G: 0.49%
All Indica  2759 98.50% 0.90% 0.00% 0.00% G: 0.58%
All Japonica  1512 29.00% 70.60% 0.07% 0.00% G: 0.33%
Aus  269 99.30% 0.00% 0.00% 0.00% G: 0.74%
Indica I  595 99.00% 0.70% 0.00% 0.00% G: 0.34%
Indica II  465 99.10% 0.20% 0.00% 0.00% G: 0.65%
Indica III  913 99.10% 0.20% 0.00% 0.00% G: 0.66%
Indica Intermediate  786 97.10% 2.30% 0.00% 0.00% G: 0.64%
Temperate Japonica  767 3.50% 96.30% 0.00% 0.00% G: 0.13%
Tropical Japonica  504 59.90% 39.10% 0.20% 0.00% G: 0.79%
Japonica Intermediate  241 45.20% 54.80% 0.00% 0.00% NA
VI/Aromatic  96 74.00% 26.00% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0106825030 C -> G LOC_Os01g12440-LOC_Os01g12460 intergenic_region ; MODIFIER silent_mutation Average:54.308; most accessible tissue: Callus, score: 90.474 N N N N
vg0106825030 C -> A LOC_Os01g12440-LOC_Os01g12460 intergenic_region ; MODIFIER silent_mutation Average:54.308; most accessible tissue: Callus, score: 90.474 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0106825030 NA 3.81E-09 mr1005 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 4.46E-09 mr1022 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 1.89E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 3.84E-06 mr1364 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 3.28E-09 mr1518 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 3.82E-35 mr1533 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 3.90E-10 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 4.64E-17 mr1699 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 2.14E-08 mr1746 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 1.47E-12 3.03E-10 mr1769 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 1.87E-15 2.42E-28 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 1.94E-77 mr1778 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 2.13E-06 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 9.33E-06 NA mr1951 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 1.53E-10 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 6.01E-07 mr1236_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 8.48E-11 3.37E-08 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 3.16E-13 4.85E-16 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 1.38E-11 mr1520_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 7.62E-09 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 1.08E-17 mr1746_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 1.86E-10 mr1746_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 2.26E-07 mr1754_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 5.34E-25 4.24E-14 mr1769_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 1.13E-24 2.22E-42 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 NA 2.01E-07 mr1821_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 6.12E-12 NA mr1951_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106825030 1.45E-10 8.42E-11 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251