Variant ID: vg0106807279 (JBrowse) | Variation Type: SNP |
Chromosome: chr01 | Position: 6807279 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CCTCCGTCCAAAAAAAGACAAACCCTAGGTTTCCATGCTCAACGTTTGACTGTTCGTCTTATATGAAATTTTTTTATAATTAGTATTTTTATTGTTGTTA[G/T]
ATGATAAAACATGATTAATATTTTATGTGTGACTTATCTTTTTAATTTATTTTTATAATTTTTTTAAATAAAACGGGTGGTCAAATGTTGGACATGGAAA
TTTCCATGTCCAACATTTGACCACCCGTTTTATTTAAAAAAATTATAAAAATAAATTAAAAAGATAAGTCACACATAAAATATTAATCATGTTTTATCAT[C/A]
TAACAACAATAAAAATACTAATTATAAAAAAATTTCATATAAGACGAACAGTCAAACGTTGAGCATGGAAACCTAGGGTTTGTCTTTTTTTGGACGGAGG
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 86.00% | 13.70% | 0.32% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 59.10% | 40.10% | 0.79% | 0.00% | NA |
Aus | 269 | 98.50% | 0.70% | 0.74% | 0.00% | NA |
Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 41.60% | 57.10% | 1.30% | 0.00% | NA |
Tropical Japonica | 504 | 86.70% | 13.30% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 57.30% | 41.90% | 0.83% | 0.00% | NA |
VI/Aromatic | 96 | 74.00% | 26.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 90.00% | 8.90% | 1.11% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0106807279 | G -> T | LOC_Os01g12430-LOC_Os01g12440 | intergenic_region ; MODIFIER | silent_mutation | Average:70.672; most accessible tissue: Callus, score: 94.1 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0106807279 | NA | 5.27E-08 | mr1624 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106807279 | 4.84E-06 | 4.84E-06 | mr1050_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106807279 | NA | 4.75E-07 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106807279 | NA | 1.20E-10 | mr1624_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106807279 | NA | 1.03E-23 | mr1679_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106807279 | NA | 2.39E-07 | mr1679_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106807279 | NA | 2.23E-07 | mr1733_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106807279 | NA | 2.05E-07 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0106807279 | NA | 8.81E-07 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |