Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0106807246:

Variant ID: vg0106807246 (JBrowse)	Variation Type: SNP
Chromosome: chr01	Position: 6807246
Reference Allele: A	Alternative Allele: T
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGTCAAAAAAAAAACAACTATACAAGAATACTCCCTCCGTCCAAAAAAAGACAAACCCTAGGTTTCCATGCTCAACGTTTGACTGTTCGTCTTATATGAA[A/T]
TTTTTTTATAATTAGTATTTTTATTGTTGTTAGATGATAAAACATGATTAATATTTTATGTGTGACTTATCTTTTTAATTTATTTTTATAATTTTTTTAA

Reverse complement sequence

TTAAAAAAATTATAAAAATAAATTAAAAAGATAAGTCACACATAAAATATTAATCATGTTTTATCATCTAACAACAATAAAAATACTAATTATAAAAAAA[T/A]
TTCATATAAGACGAACAGTCAAACGTTGAGCATGGAAACCTAGGGTTTGTCTTTTTTTGGACGGAGGGAGTATTCTTGTATAGTTGTTTTTTTTTTGACG

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	1.90%	5.18%	1.63%	NA
All Indica	2759	98.60%	0.40%	0.87%	0.11%	NA
All Japonica	1512	75.90%	5.10%	14.29%	4.76%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.00%	0.22%	0.22%	NA
Indica III	913	99.10%	0.30%	0.44%	0.11%	NA
Indica Intermediate	786	96.40%	1.00%	2.42%	0.13%	NA
Temperate Japonica	767	98.30%	0.10%	1.17%	0.39%	NA
Tropical Japonica	504	47.40%	11.30%	30.36%	10.91%	NA
Japonica Intermediate	241	63.90%	7.90%	22.41%	5.81%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	91.10%	1.10%	5.56%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0106807246	A -> T	LOC_Os01g12430-LOC_Os01g12440	intergenic_region ; MODIFIER	silent_mutation	Average:66.092; most accessible tissue: Callus, score: 94.1	N	N	N	N
vg0106807246	A -> DEL	N	N	silent_mutation	Average:66.092; most accessible tissue: Callus, score: 94.1	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0106807246	NA	2.83E-08	mr1022	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	NA	1.64E-07	mr1236	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	NA	2.40E-08	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	NA	9.63E-06	mr1364	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	1.09E-06	1.50E-06	mr1498	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	9.73E-06	NA	mr1518	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	NA	1.04E-09	mr1518	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	3.91E-06	NA	mr1676	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	NA	2.42E-10	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	1.44E-21	6.64E-28	mr1769	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	5.30E-16	7.67E-33	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	3.50E-08	2.34E-15	mr1916	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	9.19E-06	2.88E-09	mr1916	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	7.73E-06	NA	mr1925	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	9.42E-09	2.91E-14	mr1951	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	4.98E-06	2.89E-14	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	4.65E-07	1.19E-08	mr1236_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	NA	4.64E-08	mr1236_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	6.54E-15	1.74E-12	mr1498_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	1.05E-11	2.16E-14	mr1498_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	8.29E-06	NA	mr1676_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	NA	1.16E-10	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	NA	3.02E-08	mr1746_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	2.28E-29	1.01E-39	mr1769_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	2.63E-20	1.11E-43	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	5.01E-06	NA	mr1916_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	NA	5.72E-10	mr1916_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	1.10E-08	NA	mr1925_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	1.47E-11	3.33E-12	mr1951_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0106807246	3.92E-09	8.52E-11	mr1951_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251